EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07260 alignment
(2 sequences with 1485 bp)


ANKH_BRARE/1-495 ATGAAGGAATTCCCGGCTCTCACGCACTACTGGCCTCTCATCCGATTCCTGGTGCCTCTGGCCATTACCAACATCGCCATCGACCTCGGTGAACAGGCTTTAAACCGGGGAATCGCAGCAGTTAAAGAGGATGCAGTGGAAATGTTGGCCAGCTATGGTCTGGCCTACTCCCTCATGAAGTTCTTCACCGGCCCGATGAGTGATTTCAAGAACGTCGGGCTGGTGTTTGTCAACAGCAAGCGGGACAGAACCAAAGCGGTGCTCTGTATGGTCGTTGCAGGAACCGTGGCTATCGTTTTCCACACTCTCATTGCCTACACAAATCTGGGTTATTACATCATCAACAAACTGCATCATGTGGATGAGTCTGTGGGAAGTAAGACCCGGAAGGCGTTCCTGTATCTGGCTGCTTTTCCTTTGCTTGATGCCATGGCATGGACTCATGCTGGAATTCTTTTGAAGCACAAGCACAGTCTCCTTGTGGGATGTGCCTCTATTTCTGATGTCGTTGCACAGATTGTGTTTGTGGGTATTTTGCTCCACAGTCATCTGGAGTGTGTGGAGCCCATGTTGATCCCAATCCTCTCTCTGTATATGGGCGCCTTGGTACGCTTTACAATTGTTGGTCTGGGATACTACAAGGTCATTCATGACAACATCCCAGAATCCAGTGGGCCTGAGGTTGGGGGTGATGCCACTATTAAGAAGATGCTAAGCTTCTGGTGGCCACTGGCTCTCATTCTGGCTACACAGCGGATTAGCAGACCTATCGTAAACCTGTTTGTGTCTCGGGACCTTAAAGGAAGTACAGCTGCTACAGAGGCTGTCGCAGTTCTCACGGCTACATATCCAGTGGGCCACATGCCCTACGGCTGGCTCACTGAACTCCGAGCTGTTTACCCTGCTTTTGACAAGAATAACCCGAGCAACAAGTTGATCAACAGTGGTACAGTCGTGACAAAATCCCACATCAAGCGCTTCACTTTTTTCTGTCTGGCTCTTTCCATAACACTCTGTTTTATGGTGTTTTGGGCACCACACATTTCCGAGAGCATCCTGGTGGACATCATAGGAGTTGATCATGCCTTTGCTGAGCTCTGTATCACCCCATTACGAATCTTCTCCTTCTTTCCTATTCCAGTGACAATTCGCGCTCATCTGACTGGTTGGCTCATGACCCTGAAGAAGACCTTTGTCCTGGCGCCCAGCTCGGTCCTCCGCATCATTGTCCTCATTTCCAGCCTGATAGTTCTGCCTTACATGGGGGTTCACGGGGCCACTCTTGGTGTTGGATCTCTGCTGGCTGGTTTCCTTGGGGAATCTACCATGGTTGCGATTGCAGCTTGCTATGTGTATCGAAAACAGAAGAAAAAGAAAGATTCGGATGAAGACATGACCATTGATGGGGAGGATTCAGCCCCTATGAATGAGGTCCGGTCCAGAGGCCGCATGGACGACATTGTGGAGCTGAGAGAAGAAGATGAG
ANKH_RAT/1-492 ATGGTGAAATTCCCGGCGCTCACGCACTACTGGCCCCTGATCCGGTTCCTGGTGCCCCTTGGCATCACCAACATAGCCATCGACTTCGGGGAGCAGGCCTTGAACCGGGGCATTGCTGCAGTCAAGGAAGATGCAGTAGAGATGCTGGCCAGCTATGGGCTGGCGTATTCTCTGATGAAGTTCTTCGCGGGACCCATGAGTGACTTCAAGAATGTGGGCCTGGTGTTTGTGAACAGCAAGAGAGACAGGGCCAAAGCTGTCCTGTGCATGGTGGTGGCCGGTGCCATTGCTGCAGTCTTCCACACCCTGATAGCCTACAGTGACTTAGGGTACTACATCATCAACAAGCTACATCATGTGGACGAGTCTGTGGGGAGCAAAACACGAAGGGCCTTCCTGTATCTCGCTGCCTTCCCTTTTATGGATGCCATGGCGTGGACTCATGCTGGCATTCTCTTAAAACACAAATACAGTTTCCTGGTGGGATGTGCCTCAATCTCAGATGTCATAGCTCAGGTTGTGTTCGTAGCCATTTTACTTCACAGTCACCTGGAATGCCGAGAGCCGCTGCTCATCCCCATCCTGTCTCTGTACATGGGTGCACTTGTGCGCTGTACCACGCTGTGCCTGGGCTACTACAGGAACATCCACGACATCATCCCTGACAGGAGCGGCCCAGAGCTGGGGGGCGACGCAACCATAAGAAAGATGCTGAGCTTCTGGTGGCCTCTGGCTCTGATTCTGGCCACGCAGCGCATCAGCCGGCCCATTGTCAACCTCTTTGTGTCCCGGGATCTTGGTGGCAGTTCTGCTGCTACAGAGGCAGTGGCCATTCTGACAGCTACCTACCCCGTGGGTCACATGCCATATGGCTGGTTGACAGAAATCCGTGCTGTCTACCCTGCTTTTGACAAGAATAACCCCAGCAATAAACTGGCCAACACGAACAACACGGTCACCTCGGCCCACATCAAGAAGTTCACCTTCGTCTGCATGGCACTGTCACTGACGCTCTGTTTTGTAATGTTCTGGACCCCCAACGTCTCTGAGAAGATTTTGATAGACATCATTGGAGTGGACTTCGCCTTTGCAGAACTCTGTGTCATTCCTCTGCGTATCTTCTCCTTCTTCCCAGTGCCAGTGACTGTGAGAGCTCATCTCACTGGATGGTTGATGACACTTAAGAAAACCTTTGTTCTGGCACCCAGCTCCGTGCTGCGGATCATCGTCCTCATCACCAGCCTTGTGGTTCTGCCTTACCTGGGGGTGCATGGAGCCACACTAGGTGTGGGCTCCCTTCTAGCAGGGTTTGTGGGAGAGTCTACCATGGTTGCCCTCGCAGCATGCTATGTGTATCGGAAGCAGAAAAAGAAGATGGAGAATGAGTCA------GCCACCGAGGGGGAAGACTCGGCC---ATGACCGACATGCCTCCAGCAGAGGAGGTGACAGACATCGTAGAGATGAGAGAGGAAAATGAG