EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07220 alignment
(2 sequences with 2016 bp)


Q8VTZ1_LEPIN/1-667 ATGAAGTTCGGATTAGACGCAAATATTACGTATCCTCCCCTTTCCGTGATATATTCTATTTTATTAATATTGGGTTGTGATTTTTTGGGATTTTATATTCTAAAATTATTCGAAAATCACTTGGGGGAAATTAAGAATACTTGGAGGCGGTGGCAGGCTCCACTAACTGGAGCCTTATTATTGAGTGTTTCTCTTTATCCTTTAGCTTTATTTGGTTTTACTTCCCGACTTTTTATGGAAAGTGTTGCCTTTCTTTTAGTGATTTTAGGACTTATTAATTTAGGAGGCTTCATAAAAAAAATAAAATCTAATAAAGATATTTTGAATATTTCAAAACAAAACCTTGATAGATCATTGAACTTTAATATACAAACAGATCTT------------GAACAGCAAAAAAGACCATTTTTCTTGTTTAAGGAAAAATATTCCTTTATGGACAAGTTTGCTTTAATTGATATAAACAAATTTTTAAATCTATTTATAAAATTACTACTCGTTGCTTATGGATTGTTAGCTCTCTGTCCTGTAACAAATGCTGATTCTTTAGATTATCATATTGGAGTGGCGATTGAAATTTTAAATCAAGGAAAGATGCCAGCTTTTTTAGGTTGGTTTCATGGAAGATTGGCTGGAAGTGGAGAAGTTTTAAATGCTCTTGGTCTTGCTATAGGAGCCGAACAATTTGGTTCTTTACTTCAGTTTTCAGGTCTTTTAGGTATTTATGGAATATTAGCTTTTTATTCTTTTCTGGAAAAAAATTTAGCAAATGATGGTTCAGTATGGAGAGAAATCATTATAATTGCATTTCTTTCGTCTCCGGTTTTGGTCTTTTTAGTGAGTTCATCGAAACCTCAGTTACTTCAGGTTGGTATGACCTCTTTTGCCGTAGTATTGCTATTAGAAATTATTTCTAAAGCAAAAACAGATAAAAATAAATTATCGATTTTTATTCTTATTTGTATATTGATTATGTCGACTACTCAGGCAAAATTTTCATTTTTTCTGTCAGCGTTTTTAATCGGTCTTTGTTCTCTAATTTTGCTGGGTTCTATCAGATTATATATTTATGGAGTTTTGATTGGGATATTTTTCTTGATCTTAATAATTTTTCCTTCTGTATTTTGGAAGATAAAAAATTTTGATAGCTCGATGATTGATGCAATACTCGTCCCTTTACCTGGT---CCATGGCCAGGAGTTAGGTCATTTGAATCTGTACTTCGTAATTACAGAGATAGTACATTAGACTTTCCACTATCTTTATTGATTCCGAATACATTTGGAGTTGTTACTACTATAATTGGTTCTGGATTATTTTTAGTCATATTTGTAAAGCCTATTGCTAATTTACAAACGTTTGTATTGAGCTTTATTATAATTATTTTTGTAATATTAGGTATTCTGTTAGGACAAAACGCTTCTAGATTTTTTTTAGAACCATTTATTTGGATTTTAATTTCTCTAATTGTTATAGATCCAATTAAAATTCAAAATCTCAAATTTACCAGAAATGTAATAGGCTTTCTAGTAATTTTGCAAGCCGGACTGACATTTGGGATTCTTCTTTTAGGTATTTATCAATTACTTCCGGGCGTTTTTTCAATTCAATCTAGAGAAAAAGTAATGAATCAATATTCGAATGGATATAATTTGATGAAGTGGACAGGTTCAGTACTACCTAAGGATGCTGTATTATTATCGCAACATAGATCGGTTGCACTTTCTGAGAGAAAAACTTTATCTTTAGATTGGGCCAAATTTGTGAATTTTGATTCTATCATCGCAAGTCCTTATTTAAGGGAAATCAAAGACGAAAATGTAACGCATATTTTGATTTTAGGGGAGATATCTAAAGACAGCCCATTTTTTGGATGTATAGGAAATGTAATTGGTAAAACTAAAAGTCAGATTGCAATGAGAAATCCTTTAGCTCCAAAAGACCATTTTACAGCAATACTTGCAGAATTTAGAATTAATAACTTATCACAATGTTCAAATTCTGTTCTT
Q8F5M7_LEPIN/4-673 ATGAAATTCGGATTAGATGCTAATGTAGCTTATCCTCCACTATCTGTATTATATTCTATTTTTTTAATATTTGGCTGTGATTTTTTAGGATTTTATATTTTAAAATTATTTGAAAGTAGTTTAGGAAAAGTTAAAAATACTTGGATAAGATGGCAGGCCCCATTAATTGGAGCGTTACTATTAAGTGTTATCCTTTATCCTTTAGCTTTGTCTGCTCTTACACCTCGATTTTTGATGAAAAGTGCGGCTATTTTTTTATCTGTACTAGGTTGTGCTAATATTTGTTTCTTTGTTAAAAATGGGACCAAAAATTTAGTTTCGATCAGTTATTATTCC---AATATCTTCAAGAGTATTCAGTACCATTCTTTTTTTGAAAAAATTGGAAATGATAAAAAGATTAAAAAAAGTTTTTCCCTATTCAAATTAATCGGTTTTATTAAAAATAAATTTAATTTAATCAATAAAAATGATGTGCTTAACGTATTTATAATATTATTAATGATTGGTTATGGGTTTCTTGCTCTTTGTCCTATTACGAATGCAGATTCGCTAGATTATCATATTGGTGTTGCCATTGAAATTTTAAATCAGGGAAAAATGCCAGTATTCTCCGGTTGGTTTCATGGAAGATTGGCTGGAAGCGGAGAAGTTTTAAATGCCCTTGGGCTTGCTATAGGAGCGGAGCAATTTGGTTCTTTGCTTCAGTTTTGTGGTCTTTTAAGTATTTATGGAATATTATCGTTTTATTCTTTTGCCGAAAAATTCTCTGAAAGTGACGGA---GTATGGAGAAAAATTATTATAATCGCATTTCTTTCATCTCCTGTTTTGGTTTTTTTGGTCAGTTCACCGAAACCTCAGTTACTTCAGATTGGAATGACTTCTTTTGCAATAACCTTACTTTTAGAAATTTTCTCTAAAATAAAAACTGATAAAAATAAACTATTTGCATTTAGTCTTATTTGTATATTGATCATGTCTGCTACGCAGGCTAAGTTTTCCTTTTTTTTGTCAGCTTTTCTGATAGGTTTATTCTCAATTTTCTCTTTAGGTTCTATTAGATTATTTTTCTACGGATTATTAATTTCCCTTTTTTTCTTTGTTTTAATAAACTTTCCTGCGATATTTTGGAAGATAAAAAATTATAATAGCACTTTCATTGATGTACTCATTCATCCTTTACCAGGAAATACGTTTCCGGGTGTAAATGAGTTTGAGGTGTCGTTGCGTAATTATCAGGATAGTGCACTAATTTTTCCATTATCGTTAATTTTTCCTAATCAATTCGGAGTAATTACTACAGTGATTGGCTTGGGTTTATTTTTAATAATATTTGTGAAACCAATAGTAACTCAAAAAGCATTTTTATTAAGTGTAATGATAATTCTTTTTGTTATATTAGGAAGTTTAATGGGTCAAAAAGCTTCCAGATTTTTTTTGGAACCGTTTGTATGGATGTTAATTTCTTTAATTGGTTTGAATTCGTTTGGAAAGTGGAATATTAGATTTGTGAAAGAGGCAGTGAGTACAGGAATTCTATTACAAGCTTGTGCTACTTTGGTCATTATTTCTGTTGGAATTTATCAGTTGTTTCCTGGGGTTTTTTCTATTTCTCTAAGAGAAAAAGTAATGAGCCAGTATGCAAATGGTTATAGTTTAATGAAATGGGTAGGTTTAACCTTACCTAAGGAAGCCGTTTTATTATCACAGCATAGATCGATTGCACTATCCGAAAGAAAGACTTTGTCCTTAGATTGGATTCCTTTTGTGGATTTTAATTCTGCTGTTGCTAGTCCCTATTTAAAGCAAATCAAAGATGAAAATGTGACTCATATCCTAATGTTCGGAGATACGTCTAAGAATACTCCTTTTTCAGGGTGTATAGGAAATACAATAGGCAAAACTAAAAGTAACCAGGTGGCTAGAAATCCGTTTAACAGAAACGATTTTTTTACAGTAATACTCGTTGAGTTTCAGTCCGATAAATTACCGCAATGTGCGAATTTTATACTT