EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07178 alignment
(3 sequences with 285 bp)


Q8D6A4_VIBVU/6-100 CTTTTTTTTGCTATCCCAAAACACCTCAGCAAAGGCAAGCGCATATCAGGTTTACCCCGAGACGAAGTCTTGCCCGGGTTTCTTCTCTTTGTGCTCTTCTTCTTAGCCGGTAAATACTTGATAGGCCTTATCTTTGCAGCCATTTGGTTTATAGGACTTCGGTATATCAAAGTTCAGTACGGTGAAAACATCATCGCCTTAACCCTCTACTGGTGGGGGAACACCTCACTCAATCACAGTGTCTTCAAACACACTCCCGCAGCGCAAAAGCGTTACTGGCTCTCT
TRAL_SALTI/7-101 GACAAATACCGTTTCCCGAAAACCCTGTCAGAGCAGAACCGCATTATTGGACTGCCCCTTGATGAAGCTATCCCCGCAGCGGTTGTTTTGCTGTGGGGGTTTTTCACCAAGAAATATTTATTCAGTCTGATTATTGCGGCAGTTATCTGGCAACTGATCAGGGCGGCGAAATGTGGAAAAAGCTCCCGCTGGTTATACAACTGGTGTTATTGGTATCTACCCACTGAATTATTCCGGGTTGTCTACCGCGTTATTCCCGATTCCAGTTTCAGGAAATGGATAAAA
O85948_SPHAR/2-94 AATCGCTACACGGTTCCCGCGCATCTCGATGATCCGGAGCTGATCGGGTTTTGGACACTCGATGAGTTTCTCGCGATGATCGTTCCCTTCGCCTGGGGCATCCTGTCTCAACATATTTTCATCGGTCTATGTTCAAGCGTGCTGGCCTGGTGGGGATTGCGCAAGTTGAAGGCGGGACGAGCCGTCTCGTGGATCATTCATTCGGCCTACTGGTACCTGCCGGGTGCCTTTATGGGG------CTGAGAGCGACGCCGCCCTCCCATCTTCGCCTGATGGCGGGC