EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07175 alignment
(3 sequences with 552 bp)


Q8K4L6_MOUSE/27-192 ATGCCGAATGAAGACAGGAGCAGCTGC------------------------------------------------------GGCAATCAAGACAGCATTCACAAGGACTTGGCAGCATCTGTGTATCCTGATCCCACGGTGGATGAAGGCACAGAGGATGGGCAAGGTGCTCTCCTTCACCCGCCTGGCCAGGACAGGTATGGTGCTGCCCTCCTCAGAAATATCACGCAGCCTGTAAAGAGTCTAGTGACTGGGGCCGAACTACGGAGGGAAGGAAACCAGGAGAAGAGACCTCAGAGTGTTCTAAGCGTAATTCCAGCAGATGTCAATGATGCTAAAGTCTCCTTAAAAGACATAAAGAATCAAGAGAGTTATCTGCTAACCCAGAGCAGCCCGGTCAAAAGCAAACACACCAAACACACCCGCCAGACCCGACGGAGCACTCACTACCTGACACATCTCCCACAGATCAAGAAGACTCCCAGTGACCTTGAAGGCAGTGGCTCCCCAGATCTTCTAGTGAGGGGAGATAATGATGTCCCCCCTTTCAGT
Q8K3V0_RAT/27-186 AAGCTGAATGAAGATGGCAGCAGCGGC------------------------------------------------------GGTAACCAAGGCAACATCCAC---------TTAGCATCTGTGAAGCCTGAGCCCATGGTGGGTAAAGGAACAGAGGGTGGGCGAGATGCTCCCCTTCACCTGCTTGACCAGAACAGGCAGGGTGCCACCCTCCTCAGAAATATCACTCAGCCTGTAAAGAGTCTGGTGACGGGGACTGAAGTACAGAGCGACAGAAACAAAGAGAAGAAACCTCAGAGTGTTCTAAGCGTAATTCCAACAGATGTCCACAATACTAACGACTACTCAGAAGATACAGAGAACCAACAGAGGGATCTACTACTCCAGAACAGCCCAGGACAAAGC---------AAACACACCCCTCGGGCCCGACGAAGCACGCACTACCTAACACATCTCCCCCAAATCAGAAAGATTCTCAGTGACTTCGAGGACAGTGCTTCCCCAGACCTTCTAGTGAGGGGGGATAATGATGTCCCTCCTTTCAGT
Q8NC19_HUMAN/76-256 GAAGCCAGTGAGAATAAGGGAAGTAGTAAATCTCAAAATTATTTCACAAATAGACAGAGACTGAATAAAGAATATAGTATCAGTAACAAAGAGAATACTCACAATGGCCTGAGGATGTCAATTTATCCTAAGTCAACTGGGAATAAAGGGTTTGAGGATGGAGATGATGCTATCAGCAAACTACATGACCAAGAAGAATATGGCGCAGCTCTCATCAGAAATAACATGCAACATATAATGGGGCCAGTGACTGCGATTAAACTCCTGGGGGAAGAAAACAAAGAGAACACACCTAGGAATGTTCTAAACATAATCCCAGCAAGTATGAATTATGCTAAAGCACACTCGAAGGATAAAAAGAAGCCTCAAAGAGATTCCCAAGCCCAGAAAAGTCCAGTAAAAAGC---------AAAAGCACCCATCGTATTCAACACAACATTGACTACCTAAAACATCTCTCAAAAGTCAAAAAAATCCCCAGTGATTTTGAAGGCAGCGGTTATACAGATCTTCAAGAGAGAGGGGACAATGATATATCTCCTTTCAGG