EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07091 alignment
(5 sequences with 762 bp)


Q8GRA1_PSEAE/12-246 TCCTCAAAAAAATATCGTTCCCTCTGCCCGGATACCGTACGGCGGATTTTAGATCAGGAATGGGGGCGGCACAAATCG---CCTAAGCTGGCAGTGGAGGCCACTCGCACCCGGCTGCACGGGATTTGCGGGGCCTATGTCACGCCGGAATCG------------------CTCAAGGCTGCAGCAGCGGCATTATCGGTTGGCGAT---------------------GTGCAAAAGGCACTGTCGCTGCACGCCTCTACCAAGGAGCGGTTGGCCGAATTGGACTGCCTCTACGATTTTATCTTTTCTGGCGGG---...GTGCCCCATCGTGTGTTGGATATCGCTTGCGGCCTAAACCCGCTGGCCCTCTTT---------ATACGTGACATAACATCTGTATGGGCGTGCGACATCCATCAGGGGTTGGGCGATGTGATCACCCCCTTTGCCCATCATCAGGGATTGGACTTCACGTTCGCCCTGCAGGATGTGATGTGTACGCCGCCCACTGAGACGGGGGATTTGGCACTGGTATTTAAATTACTGCCTTTGCTGGAGCGAGAGCAAGCTGGCGCCGCCATGGCGCTACTGCAGGCACTAGCTACCCCTCGGATTGCCGTCAGCTTCCCCACCCGCAGTTTAGGCGGGCGCGGCAAGGGCATGGAAGCAAACTATTCCGCATGGTTCGAGGGGGCACTGCCTGATGAATTTGAAATTGAGGATACCAAGACCATTGGAATAGAGCTTGTGTACATG
GRM_MICEC/19-271 AAGAGCCGGCGCTACCAGACGGTGGCCCCGGCCACCGTGCGGCGCCTGGCCCGGGCTGCCCTCGTCGCCGCGCGGGGCGACGTGCCGGACGCGGTGAAGCGCACCAAGCGCGGGCTGCATGAGATCTACGGGGCCTTCCTGCCGCCCAGCCCGCCCAACTACGCAGCGTTGCTGCGGCAGCTCGACTCCGCTGTGGACGCCGGTGACGACGAGGCGGTCCGGGCGGCTCTGCGCCGCGCGATGTCAGTGCATGTGTCCACTCGTGAGCGATTGCCGCACCTGGCGGAGTTCTACCAGGAGATCTTCCGTCACGTGCCC...CAGCCCAACACGCTGCGTGACCTCGCCTGTGGCCTCAATCCGCTGGCCGCTCCCTGGATGGGCCTGTCGGACCAGACCGTCTACGTCGCCTCCGACATCGACGCCCGGCTGATCGGCTTCGTGGACGCCGCCCTGACGAGGCTGGGCGTCGCGCACCGTACGAGCGTGGTCGACCTCCTCGAGGACCGCCTTGACGAGCCGACCGACGTCACGCTATTGCTGAAGACGCTGCCCTGTCTGGAGACTCAGCGACGAGGCTCCGGCTGGGAAGTGATTGACATTGTCAACTCGCCGATTATCGTGGTAACCTTCCCGACCAAGTCTCTCGGTCAGCGATCGAAGGGGATGTTTCAGAACTATTCACAAAGTTTTGAGTCCCAGGCCAGAGAACGGTCGTGCCGAATTCAGCGACTGGAGATCGGCAACGAGCTGATTTACGTC
O52472_STRHI/25-276 TCGAGCCGGCGCTACCAGAGCGTCGCGCCCGAGACCGTGCGCCGGCTCGCCGCGAACGCCCTCGTGGCCAGCCGGGGCGACCTCGCGGAGGCGGTCAAGCGCACCAAGCGCAGCCTGCACGAGGTCTTCGGCGCCTACCTG---CCCAGCCCGCCCAAGTACGACGCGCTGCTGCGCCAGCTCCGGGACGCGGTCGACGCCGGCGACGACGAGGCCGTCCGGGCCGTGCTGCACCGCGCGATGTCCACGCACGCCTCCACCCGCGAGCGGCTGCCCATCCTGGAGGAGTTCTACCGGGAGGTCTTCGCCCGGCTCGAC...GCCCCGACCAGCGTGCGCGACCTGGCGTGCGGGATGAACCCGTTGGCCGCGCCCTGGATGCCCGGCTCGGACGCGTTCACCTACCACGCCTCGGACATCGACACCCGGCTCACGGAGTTCCTCGCCGCGGCCCTGGAGACGCTCGGCGTCGCCCACGACGTGCGGGTGCGCGACCTGATGACCGGGGTGGGCGAGGTGGCCACCGACGTCACCCTGCTGCTCAAGACCCTGCCCTGCATCGAGGCGCAGGGCAGGGGGCAGGGGTGGGACCTGATCGACGCGATCCGGTCGCCGGTGGTCGTGGTGAGTTTCCCGACGAAGTCCCTCGGCCAGCGTTCCAAGGGGATGTTCAACACCTACTCGGCGAATTTCGGCGCCTGGTTGGAGAACCGGCCGCACGACGTCGAGCAGGTCGAATTCAGGAACGAACTCGTCTATTTC
O50543_9ACTO/21-273 GGCGGCAGGCGGTATCGGAGCGTGACCGACCAGGCCGTTCGCCGACTGGCCAGAGCGGCACTCGCTGTGGAGGGCGGCGACGTCACCAGGGCCACCAAGCGGACCAAGCGCGGACTCCACGAGGTCTTCGGCGCCTTCATG---CCGATGACGCCCAAGTACGAGGCGCTGCTGCGCGATGTGCCGGAGGCCCTCGAGCTCGATGACCCGGAGGCGATCCGCACCGCCCTGAAACCCGCCCTCGGCGCCCACTCCTCCACCAGGGAGCGGCTCCCCATCCTCACGGAAATGTACGCCGAGGTCTTCGACCGCCTCGACaccGCCCCCGCCACCGTGCGCGACCTGGCCTGCGGGATGAACCCGCTGACCGTCCCCTGGATGCCGCTGCCCGCCGGGACGACCTACCTCGCCTCCGACATCGACCACCGTCTGATGGACTTCGCGGGAACGGTGCTCACCGCTCTCGGAGTCCCCAACCGGGTAGAGGTGCGGGACCTGTTGACGGACCCGGATCCCGAACCGGCCGACGTCACCTTCCTGTTCAAGGCCGTCCCCTGCCTTGAGGCACAGGGCAAGGGCCTCGGCTGGAAGCTGCTCGACCAGATCAATTCCCCCGTCCTGGTGGTGAGTTTCCCCACCAAGACCCTGGGCCGCCGCTCCAGGGGCATGTACCAGACCCATTCCGCGGAATTCGCCCGGCGCGTCGCCGAACGGCCCTGGAAGTGCGACGAGATCGAGTTCGGCGACGAACTCGTCTACGTG
Q8GFP9_CITFR/12-251 GAATCAAAAAAGTACGAAAACCTTGATTCAGATATTGTTGAAAAGGTTGTTTCCATTTCTGAGAAGAAATATAAA------TTAAAGGAAGTTGAGAATTATTCTAAAAAGAAATTGCATCAAATATGGGGGTCTTACTATTCTGCCTATCCTAATTGGGATAAATTATTAAAAAAGTACAATCAGGGGCAGTTATCAATAGAAGAT------------------------------TTACTAAAGATTCATTCTTCGACGAATGAAAGAGTCGCAACATTAAATGACTTTTACACTTATGTATTTGGAAATATCAAA...CATGTCTCATCTATTTTAGATTTTGGTTGTGGCTTCAATCCATTAGCTTTATACCAATGGAATGAAAATGAAAAAATAATATATCATGCATACGATATTGATAGAGCTGAGATAGCTTTTTTGAGTAGCATTATTGGGAAGTTAAAGACGACGATAAAGTATAGGTTTTTGAATAAAGAGAGTGATGTCTACAAAGGTACTTATGATGTAGTATTCCTTTTAAAGATGCTTCCTGTGCTAAAACAGCAAGATGTAAATATC---TTGGATTTCCTACAGCTTTTTCATACTCAAAACTTTGTAATATCTTTTCCAATAAAGTCTTTATCTGGAAAGGAGAAGGGAATGGAAGAGAATTACCAGCTATGGTTTGAATCTTTTACAAAAGGTTGGATAAAAATCCTTGATTCGAAGGTTATAGGGAATGAGTTAGTATATATT