EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07074 alignment
(3 sequences with 516 bp)


Q9VL69_DROME/17-186 GAAGAGGAGCTGCTGCTGCAGGACTTTAGCCGCAACGTGAGCACCAAGTCGTCGGCGCTGTTCTACGGCAATGCCTTTATCGTGTCGGCCGTTCCAATCTGGCTCTTCTGGCGCATCCACAACATGGACTTGTGGCCCAGCTCCATCCTGTTCGTCCTGGTGACGGCCGCTAGTACTTATCTGATGGCCACCGCCTACAAGAACATCAAGTTCCAGCTGAAGCACAAGATCGCCGGACGGCGGGAGGAGGCGGTGACCCGCGAGGTCAACCGTCAGGTG------GGCGATGACAAGAAGGTCACGCGCAAGGAAAAGGACGAGCGCATCCTGTGGAAGAAGAACGAGGTAGCCGACTACGAGGCCACCACCTTCTCCATCTTCTACAACAACGCCATCTACCTGGCCGTTATCATTTTCATCAGCTTCTTTATCCTGAAGAACTCGACGCCGTTCATCAACTACATCTTTTCCGTGGGCATCGCCAGCGGCGCTCTGTCGCTCTTCTCCACCAGC
SSRG_RAT/12-183 GAGGAGGACCTGCTCCTTCAGGATTTCAGCCGCAACCTGTCCGCCAAATCGTCGGCGCTGTTCTTCGGGAATGCGTTCATCGTGTCTGCCATTCCCATCTGGTTGTACTGGAGAATATGGCATATGGATCTTATCCAGTCTGCTGTTCTGTACAGCGTGATGACGTTAGTAAGCACTTACTTGGTAGCCTTTGCATACAAGAATGTAAAATTTGTTCTCAAGCACAAAGTAGCACAGAAGAGGGAAGATGCTGTTTCCAAAGAAGTGACCCGCAAACTTTCTGAAGCTGATAATAGAAAGATGTCCCGGAAGGAGAAAGATGAAAGAATCCTGTGGAAGAAGAATGAAGTTGCCGATTATGAAGCTACAACATTCTCCATCTTCTATAACAACACTCTGTTCCTGGTTCTGGTTATTGTTGCCTCCTTCTTTATACTGAAGAACTTCAACCCCAGAGTGAACTACATTCTGTCCATAAGTGCTTCATCTGGACTCATCGCCCTCTTGTCTACTGGC
Q95XS1_CAEEL/7-176 GAAGAGGAACTTCTGCTCTCGAGCTACTCGGCGACCAGCTCCACCAAGGGAAACCTCTTCTTCTACCTCAACGCGTTGATCATCTCCATCGCCCCGCTCTACCTCTTCTACGGAGTTCACCAGATGGAGATCCAAGACTCGCTTGTCGTGTGGGGACTCTCTGCCGTCGGCACTGCCTACCTCCTGTCCCTGGCCTGCAAAAACCAGAAGTGCCTTCTCAAGCATCAAATCGTGATGAAGCGCGGATCAGCTGTGGAACGCGAGATCAGCGGACAATAT------GCTGCTGACAAGAAAATGACTGTTAAGGAGAAGGAGGAGCGCGCGCTTTTCCGCAAAAACGAGGTCGCCGACACCGAATCCACCTACTTGTCGGTCTTCTACACAAACTCGCTCTACTTGACCATCATGCTCGTCTCGGCGTTCTTCTTGCTCGCCAACGTGGCTCCAGTCTTCAACTTGCTCATCTCCACCATCGGATCCGCCGGACTCGTCGCCTTCCTCTCCACCGCT