EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07054 alignment
(5 sequences with 102 bp)


Q9U617_DROME/769-802 CAGCCAAGCTATGGAAGCCAACCTGGAGTTGGAGCTCAGAATGGAGGCGGACAACCCGGATACGGTACCCGACCTGTTATTGGTGGACAGACTGGAGCCGGA
Q9U617_DROME/703-736 CAGCCCGGATATGGAACCCAACCTGGAGTTGGCACTCAGACCGGAACCGGACAACCCGGATACGGTGCCCAACCTGGTATTGGTGGACAGTCTGGAGCCGGA
Q9U617_DROME/159-192 CAGCCCGGCTATGGAAGCCAACTTGGAGTTGGCGCTCAGGCCGGTGCCGGACAACCCGGATACGGTGCCCAACCTGGAGTTGGCGCTCAGACTGGAGCTGGA
Q9U617_DROME/193-226 CAGCCCGGATATGGAAGCCAAACTGGTATTGGCGGACAGACTGGAGCCGGACAGCCCGGATACGGAAGCCAACCTGGTATTGGCGGACAGACTGGAGCCGGA
Q9VTR6_DROME/244-277 CAGCCCGGATACGGAAGCCAACCTGGTATTGGCGGACAGACTGGAGCCAGACAGCCCGGATATGTAACCCAACCTGGAGTTGGAGCTCAGACCGGAATCGGA