EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07042 alignment
(2 sequences with 846 bp)


P71176_ENTAE/126-407 AAGAAGCGAACGGCCGGCGGTGAGCTGGCCGAGAAGGTCAGCGAGGCCAAGCAGACGGCCTTGCTCAAGCACACGAAGCAGCAGATCAAGGACATGCAGCTCTCGCTGTTCGACCTGGCTCCCTGGACCGGATCACATGCGGCACTGCCCAACGACTTCGGGCGGTCGGCGATCTTCACCGTCCGCAACAAGAAGGTGCCGCGCCCCGCGCTGCAAGGCCAGTCGATCTACCACGTCAACAAAGACGTGGAGATCACCTACACCGGGATCGAGCTGCGCGCCGACGACGACGAGCTGGTATTCGCCCAGGTGCTGGAGTACGCGAACGGCACCGCGCTCGGAGAGCCGGTTTCCTTCACGTTCTACGAGCTTTGCCAGGACTTGGACTGGTCAATCAACGGTCGGTACTACACAAGGGCCGAGGAATGCCTGACGCGGCTCCAGGCGTCGGCCATGCAGTTCTCATCCCAACGCATCGGCCGGCTCGAATCGGTGTCGCTGATCCGGCGCTTCCGCGTCCTGGATCGCGGCAAGCGCACGTCGCGCTGCCAGGTCGAGATCGACGCCGAAATCGTGGTGCTGTTCGCCGGCGACCACTACACGAAATTCGTGTGGGAGAAGTACCGCAAGCTGTCGCCCAACCGCGACGGCCGCATGTTCGACTACTTCGCCACCCACAAGGAGCCGTACCCGCTCAAGCTGGAGACGTTCCGGCTGATGTGCGGCTCGGATTCCACCCGGCCGAAGAAGTGGCGCGAGCAGGTAGGCGAAGCGTGCGACGAGCTGCGCGAAAACGGCCTGGTCGAAAGTGCCTGGGTGAACGACGACCTGGTGCATTGCAAGCGG
TRFA_ECOLI/102-382 AAGCGAAAAACCGCCGGCGAGGACCTGGCAAAACAGGTCAGCGAGGCCAAGCAGGCCGCGTTGCTGAAACACACGAAGCAGCAGATCAAGGAAATGCAGCTTTCCTTGTTCGATATTGCGCCGTGGCCGGACACGATGCGAGCGATGCCAAACGACACGGCCCGCTCTGCCCTGTTCACCACGCGCAACAAGAAAATCCCGCGCGAGGCGCTGCAAAACAAGGTCATTTTCCACGTCAACAAGGACGTGAAGATCACCTACACCGGCGTCGAGCTGCGGGCCGACGATGACGAACTGGTGTGGCAGCAGGTGTTGGAGTACGCGAAGCGCACCCCTATCGGCGAGCCGATCACCTTCACGTTCTACGAGCTTTGCCAGGACCTGGGCTGGTCGATCAATGGCCGGTATTACACGAAGGCCGAGGAATGCCTGTCGCGCCTACAGGCGACGGCGATGGGCTTCACGTCCGACCGCGTTGGGCACCTGGAATCGGTGTCGCTGCTGCACCGCTTCCGCGTCCTGGACCGTGGCAAGAAAACGTCCCGTTGCCAGGTCCTGATCGACGAGGAAATCGTCGTGCTGTTTGCTGGCGACCACTACACGAAATTCATATGGGAGAAGTACCGCAAGCTGTCGCCGACG---GCCCGACGGATGTTCGACTATTTCAGCTCGCACCGGGAGCCGTACCCGCTCAAGCTGGAAACCTTCCGCCTCATGTGCGGATCGGATTCCACCCGCGTGAAGAAGTGGCGCGAGCAGGTCGGCGAAGCCTGCGAAGAGTTGCGAGGCAGCGGCCTGGTGGAACACGCCTGGGTCAATGATGACCTGGTGCATTGCAAACGC