EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07022 alignment
(8 sequences with 606 bp)


Q9XJF9_9CAUD/9-208 TTTGACTATTTGAAGGGTGACGCCTTCACATCGAAACTTAAAGTGATAACAAAATGTAAAGATTTCTTTGAGTTAGGTGCTCTTTTGAATATCCCAAAGGCAACTTTCAGCACTTGGAACACTCACGATAGAACGTCACATGAATTGATGGTGAGACTTCATTTGGCTCTTGGCATTCCTATTGAAGAGTTAGCCCTCAAGCCTGAGGATTTAAAAAGATTTCAACCGCGAGTTTCTGAACCTAAAAAAAGCTATCAATTCGAGATAGCAAAGAATCCCCAGCATGAAACCGTCATTCTCAAATCGTTCTGCCTGACAAACGGTCAGCTTCTTGAAACTGGCGAGCTCCCTTATCCCGTTCGCCGGATGAATAGCTTTAACCTG------AAATCTGGCAGCACGATTGAAGTTGAAACCAATGAGGCTCTTTATCTGGTGGATAACGATTCGCGTGATGCGGTTTCCGGTAACTACTTGATTGATATTGATGGCCGTTTATCGGTTAACCATATTCAGCGTTTACCCGGCAAAAAGCTGGCGATTGCGTTTGGTGAAAGCACGATTGAAGTATCAGAACACGACATTAAAGTGCTTGGCCGTGTC
Q8D634_VIBVU/11-195 TTTGAATATCAAGGTGGAAAGCATGTCACAGAAAGATTGTGTAAGGCACTGGATGCAAAGAACTTAAGTGAGCTTTCGAGCATCCTAAATATACCTACTTCAACAATGTCTACATGGCATAAGCGCGAGCTATGTCCTTTCGAAGTAGTGATTAGAGCTCATATGTATACAGGCGTGTCGGTACGTTGGTTGACGCTTGGTGAAGGTGAACCCTTCCCAAATCGAACGGAGCGAACTGAA---------------------------------------TCTAACCTCCTTTTCGAAATCGACTCGCACAAAGTTCTCAATGGCGAGCTAGTTTCCCATGAAGTTCTCATTTTCGACAAAACCATATTAGATGACGCT------------TCAGTCACTAACATTATGGCAATTCGCGATGGCGAAAAGACTTACATCATTGATAAAGAAACACATCAAGCTGTAAGCGGAACTTATCTAGTCGATATGGACGGCCTTCTATCGCTGAACGAGATCCAGCGTTTACCAGGTAAGAAACTGGCGATTAGCTTTAATGGATCAACTCTTACAGTTGAAGAGGATGAGGTTAAGGTTGTTGGTAGGGTT
Q8Z373_SALTI/2-180 AATTTGGAGAAAGGCGGACGAGGCGCTATAGAGCGCATGGTAGAAGCTTATGGATTCAAAACTCGACAGGCGTTGTGCGATCATTTAGGAATCTCTAAAAGTACACTCGCCACACGCTACATGCGTGACTCATTCCCAGCAGAATGGGTAATCCAGTGCGCCCTTGAAACGGGCACCTCGCTTAATTGGCTCACAACCGGACATGGTTCAAAGCAAACTTCAGGT------------------------------------------------------AATACAAATACTATGGAAGTTGCTAAATATGTATTATCTGATGGTGCCTTGCGTGAAGACGGTTTTTATATTTTTGATAAGGGATTTCTACCCTCT---------------ACGTTTAAAAAACCTTTTGTCATCACAGATAACAATTCTGAATTTATTTGTGATAAAGAATTTGATGATATACGTGATGGTAAATGGGTAATAAGTATTGATGGCGAAGTAACGATCCGTGACATTACTCGTTTACCCGGTGGAAGAATCTTCGTCGAGGGTGGAAACAGAGCCTTCGAATGTAAGATAGAAGACATTGAAATAATTGGTAAAATT
YR7I_ECOLI/13-191 AATCCCAATAAAGGTGGTAAGGCTGCGATTGAGCGATTAGTCGAAGCTTATGGCTTTACGACACGACAGGCTTTAGCTGATCACTTGGAAGTATCAAAAAGCACTCTGGCGAACAGGTATTTGCGGGATACGTTTCCTGCAGACTGGATAATCCAATGTGCTCTTGAAACAGGAACCTCACTGAAATGGTTAACCACCGGGCAAGGACTTAAGCAAAGCTCGCTG------------------------------------------------------ACAGTAGCCACAGAAGAGCTTCCCAAGTTTCGCCTTACCGCAGGCAAAATGATTGAAGATGGTTCATATGTATTCGATTCATCATTTCTTCCTGCA---------------AATCTTTCATCACCAATTGTTATTCAGGATGGGCTTGTCACATACATTTGTGATCAAAAATTTTCTGAAGTACTTGATGGACACTGGTTAATCAACATCGACGGAACCTATTCCATTCGAAAAATCACAAAGCTTCCAAAAGGTATGATTAAAATTACAACTACAGAGAATAGCTTTGAATGTGCATTTTCTGATATTGAAGTGGTTGCTTGTATA
Q8FJJ7_ECOL6/122-300 ACTATAAATCAAAACGGAAAAGCAGCAATAGAGCGAATCGTTGCAGCCTATGGATTTAAGACAAGACAAGCTTTAGCTGATCATTTGGGTATTTCAAAAAGCACACTAGCTAATCGTTATATGAGGGATACATTTCCAGCCGATTGGATTATCCAATGCGCACTTGAAACTGGTATATCACTAGATTGGCTCGTTACTGGAAAAGGCTCAAAATCGAACGATGTA------------------------------------------------------AATACTGATGTAGCAAAGTTATTAGCATATAAGCTAATAAATGGTAAGTTAATAGATGCGGACTATATCCACTTTGATAAATCTTTAATACCACAC---------------AACCTTATAAATCCGCAGGTTGTGATCGATAGCGAAAATGTTTTCGTAGTAGACTATGGATATAAAGAAATATCTGATGGTGAATGGTTAGTAGAAATTGAAGGCAAAATAAACATTAGAACATTGGTCCGCATACCCGTAGGAAAAGTTAAAGTAATATCTACTCATGCTGATTTCATATGTGACATTGAGAATATAAAACTTTTAGCAAAATGC
Q8XF97_SALTI/7-203 GGGAATGATAGTGGTGGGCGCGATGCGATTAACAGGCTTATTAAGGCTTACAATTTCAGCTCACGACAGCAGCTCTGCGAACATCTGGAAGTATCAAAAAGCACTATGGCTAACAGATACTTAAGGGATAGTTTCCCTGCTGAATGGGTAATTCAATGCGCTCTTGAAACAGGAATTTCCCTTCTATGGCTGGCTACGGGCCAAGGAGATATGTATGCGTGTGAGAACGAAGAAAGAAATCTCAAAAACGAAACCTCCGTCACGGTAAGACCACTTTCTAAAATTGTTGCTCCTAGCATCAAACATGTTGAACTGAAGAACGGTGAACTGCAGCCAAGTGATGAAATTCTTCTTGATAGCAGACTGCTCGATGGT---------------GACTCATCCAACTCTTTGTTTGTAAAAACAGCTACTGATAGCTTTGTTGTGGATACGTCTGTTAAACAAGTCAGTAATGGCTTCTGGTTAGTCGATATGGACGGAGTTAAAAGCATCGTCAAAATCGCTCGCGTTCCAGGCAACAAAATTGTAGTTCACCAAGATGAAACATCATTTGAATGCTCGGTCGACGACATTGAAGCTATCGGGCGTGCA
RPC1_BP186/5-184 TCTTTAGGATGGAGCAACGTGGATGTACTTGACCGCATCTGCGAGGCGTACGGATTTTCGCAGAAAATTCAATTAGCTAACCACTTCGATATCGCGTCCAGCTCATTGTCAAACAGGTACACCCGAGGCGCTATCTCCTATGACTTTGCGGCTCACTGTGCCCTTGAAACAGGTGCTAATCTCCAGTGGTTACTTACCGGAGAAGGAGAAGCATTTGTAAATAACAGAGAA------------------------------------------------TCGAGCGACGCAAAAAGGATTGAGGGATTCACATTAAGTGAAGAAATCCTCAAATCCGATAAACAATTGAGTGTTGATGCCCAATTTTTCACAAAA---------------CCGCTCACAGATGGGATGGCTATCCGTTCCGAGGGGAAAATTTATTTTGTGGACAAGCAA---GCATCATTGTCTGACGGCTTATGGCTAGTCGACATTGAGGGAGCAATAAGCATTCGAGAGTTAACAAAACTACCGGGTAGAAAACTACATGTTGCAGGCGGGAAGGTTCCTTTCGAATGCGGCATTGATGATATTAAAACGTTGGGGCGTGTG
RPC1_BPHP1/2-184 AAAGAATTTATCGGTGGCAAGGATGTTATTTCTCGCATCATGGAAGCGTATGGTTTTGCGAATAGAAGATTGTTAGCCGAACATCTTGGAATGCCTCACAGTACCTTTGGCACCTGGGCTAAACGCGGTTTTTTTCCTGCTGAATTAGTCATTCGCTGCGTGTCAGAAACGGGCGCAAGATTGGATTATGTGGCCTATGGAAATGAGCCGATTTTTGATAAT---------------------------------------------------------TCAGACGATCTGAAATATTTTCATACAATAAAGCTAGAAAGCGGAAAATCTTTCATAGTAGAAAATAAACCCTTTCTTTTGCCTTACTTACCGAATTTAGACAGCCGTGAAAGTTATGACAAAGTGTTTCGTATTGATGAAGACAATCACACCTACTTTGCGACTAGCGATTACGGCAATTTAGTGGATGGCGAATACTTCGTCATCGTCGAAAACTCCCATCTTATCCGTTATATCACTGTGTTACCTGCAGGGAAAATCCGTGTAGACGGCGGCAAATTCAGTTTTGAATGTGAATTGAGTGATATTGATGTGGTGGGGAAGGTG