EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07021 alignment
(7 sequences with 585 bp)


Q9JUU0_NEIMA/4-192 CGCGATGATTTGCAACTGATTTACGACCGGATACCCGAAGGCAGCCGCGTCTTGGACTTGGGCTGCGGCGACGGCGAACTGCTTGCCGCCTCGGTCGAACACAAAAAATGCAGCGGCTACGGCATCGAAATCGACACCGACAGCGTGATTGCCGCGATGTCGCGCGGCGTGAATGTTATCCAAGCCGATTTGGAAGAAGGTTTAACCGCATTCAACGATCAAAGTTTTGATGTGATTGTGTTGAGCCAGACCATCCAAGCGATGCAGAATACCGAAAAAATCCTGCGCTGCCTGATGCGCGTGGCAAAACAGGCAATCGTCAGCTTCCCGAATTTCGGCTACTGGCGCAACCGCGTCCAAATCGCACTCGGCGGACATATGCCGGTTTCCGAACGTATGCCCTACCATTGGTACGACACGCCCAATATCCATTGGTGCACGCTCAAAGACTTTGATTTGTTGTGCGCCAAAAACAACATCCGCGTGCTTGAGCGCGCCGTGATGACGGGCAACAGA------------------CAGGTCAAACATTTCCCCAACCTTTTGGGCAGCCTTGCATTTTACCGCGTC
Q87V89_PSESM/2-194 AGAGCCGATCTGGAAATCATCCAGGAATGGATCCCCGCAGGCAGCCGTGTGCTCGACCTCGGTTGCGGCGACGGCGAATTGCTGACCTGGCTGCGTGATCACAAGCAGGTCACCGGTTACGGGCTGGAAAACGACGCAGCCAACATCGCCGAATGCGTGGCCAAGGGCATTAACGTCATCGAGCAGGACCTCGACAAGGGGCTGGGCAACTTTGCCAGCAACAGCTTTGACGTGGTGGTCATGACCCAGGCCCTGCAAGCGGTGCATTACCCGGACAGAATCCTCGACGAGATGCTGCGCGTCGGACGTCAGTGCATCATCACCTTCCCGAACTTCGGCCATTGGCGCTGCCGCTGGTATCTGGCGAGCAAAGGCCGCATGCCGGTGTCGGATTTTCTGCCGTACACCTGGTACAACACACCGAACATCCACTTCTGCACCTTCGGCGACTTCGAAGAACTGTGCCGCGAGCGCGACGCACAGGTGCTCGACAGGCTAGCCGTCGATCAGCAGCACCGTCACGGCTGG------GCCAGCAAACTGTGGCCCAATCTGCTCGGCGAAATCGGTATCTACCGGGTC
Q8Y3F4_RALSO/25-212 CGCGCCGACTTCCGCGCCATCGCCCGCTGGATCGAACCGCGCTCCACCGTGCTCGACCTGGGCTGCGGCGACGGCAGCCTGCTGCGCGTACTGCAAAACGAGCTGGACGTGCTGGCCTACGGCATCGAGATCGACGACGCCGGCGTGCTGGCCGCCACGCAGAAAGGCTTGCACGTGATCCAGCAGAACCTGGAAGGCGGCCTGGCGCTGTTCGAAGACAAGAGCTTCGATATGGTGATCCTCTCGCAGACCCTGCAGACCATCCACAACACCGCGCAGGTGCTGCGCGAGATGCTGCGGGTGGGGCGCGAGTGCATCGTGTCGTTCCCGAACTTCGGCTACTGGCCGCACCGGCTGTCGATCTTC---CGCGGGCGCATGCCGGTATCGAAATCGCTGCCGTACGAGTGGTACGACACGCCCAACGTGCGCGTGCTGACCATCCGCGACTTCGAGGCGCTGGCGCCCAAGGTCGGGCTGGTGATCCTCGACCGCGTCGTGCTGCACGAGGGCAGG------------------GCGGTGCACTGGGGGGCCAACTGGCGCGGCAACGTGGCGGTCTATCGCGTG
Q9AAS2_CAUCR/6-200 CGCGAGGACTTCCGCGAAATCCTGCGCCTGGTGCGCCCCGGCTCGCGCGTGCTGGATGTCGGCTGCGGCGAAGGTGTGCTGCTGGACCTTCTGGCCCATGAAAAGCAGGTGGACGCTCGGGGCCTGGAGCTCAGCGCCTCGGGCGTGGCCGCCTGCATGGCGCGTGGCCTGTCGGTCGTGCAGGGCGACGCTGACCTGGATCTCGACCACTTCCCCGATCGCTCGTTCGACTATGCGGTGCTGTCTCAGACCCTGCAGGCGACGCGCAATCCGCGTCACGTGCTGGACGAGCTGCTGCGCATCGCTGATCGGGCCATCGTCTCGTTCCCGAACTTCGGCCACTGGCGCGTGCGCTGGTCGCTCTTGAGCCGTGGCCGGATGCCCGAGACCAAGGCCCTGCCCCTGCCCTGGTGGTCGACCCCGAACATCCACCTCTGCACCCTGGCCGACTTCATGGCCCTGACCCAGGATCTCAACCTGCGGGTCGACGCCAGCGCCGCCTTCGCCGGCAAGGGCGCGGCGCGGCCGATGAACCCGACCAGCGCCTGGGAGAACTGGCGCAGCGAAACCTGCCTGTTCATGCTC
Q98G08_RHILO/8-202 CGCGTCGACCTCGAGGTCGTCGCCAACCTCATCCCACCGCAGTCCCGCGTGCTCGACGTCGGTTCGGGCGACGGATCGCTGCTTGAATTGCTGCAGGACACCAAGCAGGTCGACGGCCGCGGGCTTGAGCTGTCGCAGCGCGGCGTCAACGAATGCGTGGCACGCGGCCTCTCCGTCATCCAGGGCGATGCCGACAAGGATCTCGAATTCTATCCCGACAAGGGCTTTGACTTCGTCGTCCTGTCGCAGACCTTGCAGGCCACCCGCAACCCGAAGCTGGTGCTCGACGAACTGCTCCGCATCGGCAACCGGGCGATCGTCTCCTTCCCCAATTTCGGCCATTGGCGGGTGCGTCTGTCGCTGTTCGTCAAGGGCCGCATGCCGGTGACCCAGGACCTGCCCTATTCCTGGTACGACACCCCCAACATCCACTTCTGCACCATCCGCGATTTCGTCAATTTGTGCGAAGAACTCGGCGCGACGGTGGAAAAGGCGACCGCGCTCGACGCCGCCGGCCAGAAGATCGGCCTGTCCATGCCCTGGTGGTTCTGGAACTTCTTTGGCCAGCAGGCGGTGTTCCTGCTG
Q89UL6_BRAJA/24-217 CGCGCCGACCATCTGCTCGTCGCCGAGATGGTCAAGCCGGGCTCCAAGGTGCTCGATGTCGGCTGCGGTGACGGTGATCTGCTCCAGCTTCTG---GAGACCCGCGGCATCGACGGTCGCGGCATCGAATTGTCGCGCGAGGGCGTCAACCGCTGCGTCGCCAAGGGCCTCGCGGTGGTGCAGGGCGACGCCGATACCGACCTCGTGAACTATCCCGATGATGCCTTCGACTACGTGATCCTGTCGCAGACGCTCCAGGCGACGCGGCAGCCGCGTGTGGTGTTGGAAAATCTCCTGCGCATCGGCCGCCGCGCCATCGTCTCGTTCCCGAACTTCGGCTTCTGGAAGATGCGGCTCCAACTCCTGATCGGCGGCCACATGCCGCGCACCGAGAACCTGCCGGCGACCTGGTACGACACCGCCAACATCCACTTCTGCACCATCAAGGATTTCGTCGAGCTCTGCGACGAGATCAACGTCAAGATGGAACGCTCGGTGGCGCTCGATCTCTATGGCCGCCCGGTGCCGCTGAACCTGCCCTGGTGGGTGTGGAATATGTTCGGCGAGCAGGGCGTGTTTCTGCTC
Q8F4I1_LEPIN/17-204 AGACCGGACTTCGCCTACATTCTCAACTTGATTCCTGACGGCTCTAGAGTTTTGGATTTAGGATGTGGAAACGGAACGTTACTCTATCTTTTAAAAGAA---AAAGGAATCCGAGGACAGGGAATCGAAAAAGATGAAGATTGTATCGTAGAATGTATCCAACGAGGAGTCTATGTTCATCACGGAGATATCGACGAAGGTTTGGAACATCATCAAGACAAACGTTTTGATTACGTAATTCTCAACCAAACGATTCAAGAAACTAGAAATCCAGGAGAAATTTTAAAAGAATCGTTGCGGATCGGTAAAAAAGTAATCGTAGCATTTCCAAACTTCGGACACTGGAACGTTCGTTGGAAAATTTTGACCACGGGTAAAACACCTGTAACAGATTTGCTTCCCTATCGCTGGTTCAATACTCCTAACCTTCATTTTCTTTCAGTTTTGGATTTTATAGAATTTTGCGAAATCCAAAAATTTAAGATCGAAGACAGGGCTTACTTCAGAGATTTATCC------------------CAGGTTCGCTTTCGCCCCAACTTCTTTTCTAAGCTTGCGCTTTTCGTAATA