EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07020 alignment
(2 sequences with 189 bp)


Q66298_COWPX/1-63 ATGTCTTCTAAAGGAGGTAGTAGCGGTGGTATGTGGAGTGTCTTCATTCACGGACATGATGGCTGTAGTAAAGGATCTAAAACTTATACATCTGGTGGAGGTGGAATGTGGGGAGGATCGTCTAGTGGTGTAAAAAGTGGAGTTAATGGAGGTGTTAACGGAGGTGTAAACTCTGGAGTTAATAAAATT
P87610_COWPX/1-62 ATGTCTTCTAAAGGAGGTAGT---GGTGGCATGTGGAGTGTCTTTATCCATGGACATGATGGTAGTAGTAAAGGATCTAAAACTTATACATCTGGTGGCGGTGGAATGTGGGGAGGATCGTCAAGTGGTGTAAAAAGTGGGGTTAATGGAGGTGTTAACGGAGGTGTAAAATCTGGAACTGGTAAAATT