EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06872 alignment
(3 sequences with 1194 bp)


Q9EZE8_ECOLI/1-390 ATGATAAATGGCATTTCTCAACTG------------------AGGTCTATTCAGTCAAATTCAGCTCAGTCAAATTCAGCTTTATTCGCTCTGGAATCGGTATTAGACGTAAGTTCTTACCTGGAAAATAACTGGTCTGACAAGCCATGGGCTGAGCGAATTCTAAGCTACTTAGGTTTAAGCCATTGTAGGTCGGAGTATAAAGGTGACGACCGA---TTATTATTGGATGTATTAAGTATATTAAAACCGATATTACCAAGTAGTAATGAAGCAGGAAAAGTGCAGGCAAGTTTTTCGGATGGCTCCAGGCTAACCATTTCAGTCACAAAAAGTGAGCTGATTGAAATAGCTGTTACTACCCCAGAAGGGGATGAGGTTTCCATATTTCCTGAAAGAAATAAACAAGATTGTTTACTGAAATCATTACCTGTTGCTTTGCATATGCCATATATTAAAAAACATCATTCTTTACCGGAAATTGAGGTGAATGGGGCTGATGGCATGCGTTTTTTATGTAATTTTGCTGCCAAACTTTCAACAGCAATAGTTCCTTATAGTGAAAAAACGAATCCCCTTTCTGGCGTAAGCCCCCTGAATTCTATATATGCAGATACGTTCAGAGGGCTTGGAAACTCAGACGTCTCTATTAATGGTGTAAGTTTATCTCGTGAAGCTCAGCAACTTCTTTGTCATTTTATTGGTCTTAAAGATACAGGCTCTTCTCCTCCCTCAAACATCATAAATAACGGTATTGATTATGATCAGGCTGTTATCTTGGTCTCTAAAAGTCATGTTGGAGAAGAACAAAAGGCCCTTTTGACTGCGGTACTGTGTCAGCCTGAATTTGTTGCTGCTATATGTTCCTCTTTCTATCAATCGTTTACTGTTCCTGCTTTTTTGTTAATGCATGAGCGAATATTTCTCGCGCGTCAGCATTTTTCAGAAAAATCATTAGTTTTACCAAATGCACATTTTAGTATAAATATATCGAATTCTTCAAATGGTGGACTCTATGTTTTTAACAATGTGGGTACCTTCATCATGGCTCCGGGAGAGAGAGGTGATGTTGTCGGTGTATTTACTATGAGAACATCTTATGAAATACCTTTGGGTACCAGGTGTGAAATACCTGAGCTCGTTCGAGTGATTAAACCCATTTACAGTGCATCTGAAGCATATTCGAGGAAT---
Q93FI9_9ENTR/1-398 ATGATACTCGTTATCAAGATATTCGTAATTGATGAAACAGAGAGAGCTTTCATGTTAAACGGACTTAATAATAATTCCGCATCTTTAGTTTTAGATGCTACAATTAAAATTAACTCTGATTATAAAAAGCCGTGGAATGAGATGACATGTGCAGAAAAATTGCTAAAAATTCTCACTTTGGGGTTATGGAATCCAAAGTATTCTCAGGATGAAAGACAACAATTTCAAGGGTTGTTAACCGTTTTAGAACCTGTATCTCCCGCTCACAATGAATTAGGCAGAGTATATGCGAAATTTTCAGATGGCTCATCCTTAAGAATTTCCGTCACTAACAGCGAACTCATTGAAGCAGAGATTCACACGCCGAATAATGAAAAGTTTCTTGTACTCCTGGAGGCAAACGAACAAAATCGGCTATTACAATCTTTACCCATCAATCGCCACATGCCATACATTCAGGTTCATCATACCTTACCTCAGGAGGAACTGACTGATCTTCTGTCAATGCACAAACTACTTAGTTTTACTTCCAAATTATCAGCAACTTTGATTCCTCATAATAATCAAACAGATCCGCTTTCTGGACTTACGCCATTCAGCACTGTGTTTATGGATACGTCTCGGGGACTCGGCAATTCAAAGCTTTCACTCAATGGTGTTGATATACCTGCAGATGCACAAAAATTGCTTCGCAATACGCTAGGGCTTAAAGACACAAATTCATCCCCTGATCTAAATGTTATTAGGAATGGTATTCCTCGTCATTATGCAGAACAAATCGTAAAGGAAAGCAGCAGTACCAATGAGCAGAAAGCTGCAGTTGTGGATTTTTTATGTCAGCCCGAAGCGCCAACTGCCATATGCTCGGCTTTCTATCAGTCCTTCAATGTTCCAGCCTTAATGTTGACACATGTAAGGATCTCTCAAGCTAGTGCATATAATGCACAAAGATCGTTAGATATGCCTAATGCTTGTATTAACATAAGCATCACTCAATCATCAGAGGGAAGCATTCACGTTACCAGCCATACTGGAGTTTTAATCATGGCGCCAGAGGACCGTCCCAACCAATTAGGGATGTTGACGAACAGAACCTCTTATGAGGTGCCGCCAGGTGTGAAATGTGAACCTAATGAGATGGCAAGGATGTTAAAAGCAAAATATGCCTCATCTGAAACATATCTGAACAATGCT
O52121_ECOLI/1-398 ATGATACTTGTTGCCAAATTGTTCATTACAAACCAGATAGGAGAATCTCTCATGATAAATGGACTTAATAATGACTCCGCATCTTTAGTTTTAGATGCTGCAATGAAAGTTAATTCTGGGTTTAAAAAAAGCTGGGATGAGATGTCATGCGCTGAAAAGTTACTTAAAGTACTTAGTTTTGGTTTATGGAATCCAACGTACAGTCGTAGTGAAAGACAATCATTTCAAGAGTTGTTAACCGTTTTAGAGCCTGTATATCCACTTCCCAATGAATTAGGCAGAGTATCTGCTCGTTTTTCAGATGGCTCATCCTTAAGAATTTCCGTCACTAACAGCGAAAGTATTGAAGCCGAGATTCGCACACCAGATAATGAAAAGATTACTGTGCTCCTGGAGTCAAACGAACAAAATAGGTTATTACAATCTTTACCCATCGATCGCCACATGCCATACATTCAGGTTCATCGTGCCTTATCTGAGATGGACCTGACTGATACTACCTCAATGCGCAATCTACTTGGTTTTACGTCAAAACTATCAACAACCTTGATTCCTCATAATGCTCAAACAGATCCGCTTTCCGGGCCTACACCATTCAGCTCTATCTTTATGGATACATGTCGAGGACTCGGCAATGCAAAGCTTTCACTCAATGGTGTTGATATACCTGCAAATGCACAAATGTTGCTTCGCGATGCACTAGGACTTAAAGACACACACTCATCACCTTCCCGGAATGTTATAGATCATGGTATTTCTCGCCATGATGCAGAGCAAATAGCAAGAGAAAGCAGCGGCAGCGATAATCAGAAAGCTGAAGTTGTGGAATTTTTATGCCATCCAGAAGCAGCAACGGCCATATGCTCGGCTTTCTATCAATCTTTCAATGTGCCAGCCTTAACGTTGACACATGAAAGGATCTCTAAAGCCAGTGAATACAATGCGGAAAGATCGTTAGATACACCTAACGCTTGCATTAACATCAGTATCTCTCAATCATCAGATGGAAACATTTATGTTACCAGCCATACCGGGGTTCTGATAATGGCGCCAGAAGACCGCCCCAACGAGATGGGCATGTTGACGAACAGGACTTCTTATGAAGTGCCGCAAGGTGTGAAATGTACAATCGATGAAATGGTAAGAGCGCTACAACCAAGGTATGCCGCATCTGAAACGTACTTACAAAACACT