EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06719 alignment
(24 sequences with 477 bp)


Q88K66_PSEPK/29-184 ACCCTCCTGCCCCAAGTGCAGGTGTTGAGCTGGGACCACTATGTGGCCAGCAGCCCACAGATTTACGAACCCAGCCTCATGATCGTGGCCCAGGGCAGCAAGCTGGCACGCCTGGGGCCGCGTACCCTGGAGTACGGTGCAGGGCATTACCTGGTGCAGGCGTTGTCGGTGCCGTTCATGTGTGAAACCTTT---GCCACCCGCGAGGCGCCGCTGTTGGGCGTGGCGGTGGGCATCGACCGTGGCGTGCTGGGCGAGTTGGTGCAGAGCATGGGCTTGGCACCGGAC---...GCTGAAGTGCAGGCGCAAACCCCGCAATCGATGACCTCGGCGGCACTGGATGCACCCATGCGCGAAAGTGTGGAACGGCTGCTGCACTGCCTGCAGGACCCGCTTGACGCCAAGGTACTGGGCCCGGCGCGCGTACGCGAGGTGCTGTATACCGCGCTGCGCGGCCCGCAGGCCGGTGTGTTG
Q884B2_PSESM/29-184 ACGCATTTGCCCGCGGTCCGTGTGCTGTCGGCTTTTGGTTATGTGGCCAGTAGCCCGCAGATCTACGAGCCGAGCCTGATGATTGTGGTGCAGGGCAGCAAAGTCGCCTGTCTGGGGCCGCGCACTTTTGAATACGGCACTGGGCATTACCTGATTCAGGCGCTGTCGGTGCCGTTCAAATGCGAGACCTTC---GCCACCCCGGGCAAGCCGCTGTATGGCGTGTCGGTGGCCATCGACCGCGTGCTGCTTGGCGAGCTGGTGCAAGCGATGGGCCCGGCCAGCGGC---...CAGGAAAGCCAGATGCAGACCCCGGAGTCCATGACATCGGTACGCATCGACCCTGCGATGCGCGACAGCGTCGAACGCCTGTTGCGCTGTCTGCACGATCCGCTGGAGTGTCAGGCGATGGGGCAGGCGCGCATTCGTGAAGTGCTGTACAGCGCGCTACGCGGCCCGCAATCGGGTGTATTG
Q9I1J8_PSEAE/24-181 ACCCGCATCCCCGGGGTTCGCCTGATGCGCGCCGAACAGGCCTATCCGCGCAGCCCGGTGTTCTATGAGCCGCGCATCTGCATCCTCGCCCAGGGCCAGAAGATCGGTTTCCTCGGCGGCGAAACCTACCGCTACGACGCCGAACGCTACCTGGTGATGTCGGTGCCCCTGCCGTTCGAATGCGAAACC---CACGCCTCCGCCGCCGAACCCTTGCTGGGAGTGAGCGTCGACGTGGATATCGGCACCTTGAAGGAACTGCTGCTACAGATGGAAGAGGCTCCCGGCAGCgacGACGACAATGAGCTGGCACCCAGCGCGCCGATGGCTTCGGTACCGCTGGACGCGGGGATGGCCGATGCGGTGATGCGCCTGCTGGGCTGCCTGCAGAGCCCGCTGGACAGCCATATCCTCGGCCCGCAACTGGTCCGCGAGATCATCTTCCGCGCCCTGCGCAGCGAGCAGGGCAACGCCCTG
Q9I3W4_PSEAE/35-189 ACCGGGCTCGACTGCGTCCGCCTGCTGCGTTCGGATCGTCCGCTGGCGCGGACGCCGGTGCTCTACGATCCGGGGATCGTCATCGTTTGCCAGGGGCGAAAGCGCGGCTATTTCGGCGAGCAGATCTACCTGTACGACGAGCAGCACTACCTGGCCGTGGCGGTGCCGGTGCCGTTCACCATGGAGACC---GATGCCACGCCAGAGCGACCGCTGCTGGCGATCTACCTGCACCTGGATTTCCCGCTGGCGGCCGGGCTGGCGGTGGAGATCGACCGTCAGCGCGCG---...---CTTGCGCAGGTCGAAGCGCCGCGCAGTCTGATGTCCAGCCCTATGGACGCGCCGCTGCGGGCATCGGTGTTGCGCTTCCTGGAGGCGCTGGGCGATCCTCTGGAGACAGCGATCCTCGCGCCTGCGCTACTGCGCGAGCTGTACTTCCGCGTGCTCACCGGCCCTCAGGGCGGCGCCATG
Q8FDL2_ECOL6/102-256 GAGCTGTTGCCCGATGTGCGTTTGTTGTATGGCGAGACGCCTTTCGCACGCACACCGGTGATGTACGAGCCTGGCATCATAATTCTCTTTTCCGGACATAAAATCGGTTATATCAATGAACGCGTGTTTCGTTATGACGCTAATGAATATCTCCTGCTGACGGTGCCGTTGCCGTTTGAGTGCGAAACCTAT---GCCACGTCAGAGGTGCCGCTGGCAGGGTTGCGTCTCAATGTCGATATTTTGCAGTTACAGGAACTGTTGATGGACATTGGCGAAGATGAACAT---...---TTTCAGCCGTCAATGGCAGCCAGCGGTATTAACTCCGCCACGTTATCAGAAGAGATTTTATGCGCGGCAGAGCGGTTACTGGATGTGATGGAGCGACCGCTGGATGCGCGCATTCTCGGCAAACAGATTATCCGCGAAATTCTGTACTACGTGCTGACCGGACCTTGCGGCGGCGCGTTA
Q8ZI37_YERPE/27-181 TCAACGGTATCCGGGGTGAAAATTTTGTACTCTACAGTGCATCAACCGCGAACACCGGTAATGTACACCCCCAGTGTGGTGATTATATTTCAGGGACACAAAGTGGGTTATCTGGGTAGTAAAGTGTTTCAGTATGATCCCAAAAACTACCTCATCCTGAGTGTTCCGCTGCCGTTTGAGTGTGAAACGTTT---GCCAGCCCTGAAATACCATTGGCCGGGATTTCCATTCAAGTAGACAGCCAGATGTTACAAGATTTGATGATGACTATGGGGGATGACGAGCTG---...---GAAAAACCGCCGGGCAATACCTCGGGTGTGAACTCTGCCCCTCTGACTGAAGAGATGCTGTGTGCAACAGAACGGCTCTTGGATGTGATGTCCATTGCCCGTGATGCCCGCGTCCTTGGTCCGCAAATTGTGCGAGAAATTCTCTACTACGTCTTGTGTGGGTCATGCGGTGGGGCCTTG
Q8D7E2_VIBVU/26-183 ACCGACATACCTGGGGTTCGTTTTTATCGAAGCAGCCGAGGTAATCCACGGCACCCATTTGTTTATCAATCTGGAATTATTGTACTCGGGCAGGGTTACAAAAATATTCATATTGGTGATCATGCTGTGTGCTATGGCGCAGATGATTATTTGGTGGTGGGTGTGCCAATGCCGCTCGAATGTGAAGCGTTT---GCGGATGACGATAAGCCTTTGCTGGGGATCTCTGTTGATGTACCAATGGTTTTGCTGCAGCAAATGGTTCAGAAGCTAGAAAAGCACGGCTACCAAaatATTTGCAGTGGCAAAGAAGAAAGCTGCGGCTTGAAGTCGGTGAAAATGGAAGCGAGCATGCTTAACGCTTGCAAGCGCTTAATGCGGGGATTGTGTGATCCTCTTGAAACTGAAGTGCTAGGCCAATCATTACTAGAAGAGGTGGTTTATCGTGCGTTACTGAGCCCTAAAGGCTATGTGCTG
Q87HX6_VIBPA/30-186 ACTGCTATCGAAGGCGTTTGGTTTTATCGCAGTAGCAAAGGCAATAACCGTCAACCATTTGTGTATCAATCAGGGATCATTGTGCTTGGCCAAGGGCATAAAAACATCCATATAGGGCAAACGCCAGTTCAGTATGGTCCGGATGACTATTTGGTGGTGGGTGTACCTATGCCTCTAGAGTGTGAAGCATTT---GCCACCAACAATGAGCCTTTGCTCGGTATTTCTATCGACATCTCGCCAACGTTGCTGCACAAACTTGTGAAAAAGCTC---GAAGCACAGAAATTCagtAATATCTGCGAAGATTCTAAACGTTGTGGCCTCAAATCGGTTCGAATGAACGACGCCATGCTCGATGCTTGCAAGCGATTAATGAAGGCGCTTTGCAACGATTTGGATGTGGCGATATTGGGCGAGTCCTTACTAGAAGAAATTGTCTATCGAACGCTTGTAAGTAAAGAAGGGTACGTGTTG
Q880S9_PSESM/23-176 ACGCCGATCCCACGGGTGGATATCTGCGTCGGCCAGGGCTTTACCGAAAAGGCGCCGTGCCTGTATCGCTCAATGATCTGCTTCATCCTGCAAGGGTCGAAGCGCGTTGCGATCAACGACAATCTTCTGAGCTACGACAGCGAGCACTACCTGATCAGCGCCCTGGACCTGCCTTTGATCGGGCAGATTCTTGATGCCGAAGACGGGCAACCTTATGTTGCGGTATCGCTCGTGCTGGACCCGGCCTTATTGGCGGTACTGGCGGCGAGCATGCCTGCGGTTCGCGAG---...---------CGGGAGCAGAAAGGCATTGGCATCACGATCAACCCGATGAGCGCGCCGCTGCGAGACACCTTGCTGCGCTTGTTGTCATTGCTCGACACGCCTGACGATATCCCGATTCTGGCGCCCATGGTCGAACGGGAGTTGCTCTATCGTCTTCTTCAAGGGCCTCAAGGGCGGCTGTTG
Q8XW77_RALSO/23-176 ACGCCGATTCCACGGCTTGAACTGAGTGTGGGTAGCGCCTCTGCAGGCAAGGCACCGTGTCTTTATCGCTCGATGATCTGCTTCATCCTGCAAGGGTCCAAGCGTGTAGCGATCAACGACGAGCTTCTGGGCTACGACAGCGCGCAGTATCTGATCAGTGCCCTCGAACTACCTCTCAGCGGTGAGATCCTCGATGCAGGTCCAGGGAAACCCTATGTCGCCGTATCGCTGGTACTTGAACCTGTTTTATTGGCAGAGCTGGTGGCCGCCATGCCCTCGGCACGTGAA---...---------AGCGAATCGCATGGCTCCGGCATTGCAATCAATCCGATGAACGCCCCGCTGCGTGAGTCGTTGCTTCGCTTGCTCTCGTTACTCGATACGCCGTCTGACGTCCCGGTTCTCGCTGCCATGATGGAGCGGGAGTTGCTTTATCGTCTCTTGCAAGGTCCGCAGGGACGGTTGCTG
Q98H75_RHILO/23-172 ACGGCCATCCCGCGTGTCACCATCGGCCGCAGCGAGGTTGCGACTCCGCCACTGCCCGAGCTTTGTCAGCCGACGGCGCTGTTCGTGCTGCAAGGTGCGAAGACTGTGCTGATCGGCGACCGCACGCTTCGCTACGGCGCCGGCAGCTATTTCGTCTATGCGGTGGAGACGCCCGCCACCAGCCAGCTGATCGAGGCGAGCAGCGCCCGTCCTTACATGGCCATCGCCTTCGCCCTCGATGTCGGACTGATCGCCAGCCTGCTTATCGACCACACACCGGCGGTCGAC---...---------------------GGCGACAGCTTCGTGACCAACCGGTTGGATGATGAACTGCTCGATGCCTGGCGCCGCATGCTGCGGCTGCTCGACCGTCCGGCTGAAATCCCGGTGCTGGCGCCCATGCTTGAACGCGAGATCGCATTCCGCCTGTTGCAAGGCCCGCAAGGCGCGAAGCTG
Q98IX9_RHILO/23-175 ACCGGCATCCCCCGCGTCGCCATCATGAAGGGCGAGGCGACGACCGGGCCGTTGCTGGGGCTCTACGACCCAAGGCTTTGCCTGGTCCTGCAGGGCGCCAAATCCGTCATGATCGGCGATCAGCTGCTGCATTACGACGCCGGCCGCTACTTCATTGCCGCGGTCGAAGTGCCGGCCGTCGGCAGGGTTTTGCAGGCCAGCCCACAGCATCCCTACCTCTCCGTCAGCCTGGCCTTCGACACCACGCTCATCGCCTCGCTGCTGCTCGACATGCCGCCCGTTGCCGAG---...------------GCGCCGATCGGCCATGGCTTTGCCGTCAGCCGGGCCGACGAGGCGCTGGTCGATGCGTGGCTGCGCATGATTGAGCTCATCGATCATCCGGCCGAAATCCCAGTGCTGGCGCCCTTGCTCGAACGCGAAATCCTCTTTCGGCTGCTGCAAGGTCCGCAAGGCGCCATGCTG
Q92MD3_RHIME/28-182 ACGATTATGCCGGGGCTGAGCGTTCATCGGCATTCCGTTTCCGCGAAGCCGAATTGCGCCGCCTACAAGCCGAGCCTGGCGATCATCGTCCAGGGAGCCAAACGTGTCGTGCTCGGTGAGGAAACCCTCGTCTACGGCGCCTCGGACTACCTTTTGACCTCCATCGACCTGCCGGTTCTCTCTCAGATATCGCTCGCCTCGCCCGAGGAGCCCTATCTCAGCATGGTCTTCCAGATCGATACGACGAGGCTTCCGGCGCTCCTCGACGCCATCGGCCCGGAGGCTGCG---...------AAAGCTCCGGCTTCGCCGCGCGGCATGACGGTCAGCAAGCTCACTCCCGATCTTGAGGACACGGCGCTTCGGCTGCTGCGGCTCCTCGACCGCCCGGACGACATTGCGGTGCTGCTGCCGCTGGTCGAGCAGGAACTGCTTTATCGGCTGCTGCTCGGACCGCACGGCGCCAGGCTC
Q8UDU8_AGRT5/27-182 ACGGCGATCGAATCCCTCGGCATCAGTCGGCGCACGATCCCCAGCGCACCATGCCACGGCAATTACCGCCCCTGTCTCGCTATGGTAATCCAGGGGTCGAAAAGCGTGCAATTGGGCACGGACACCATAAATTACGGCGCGGGTGATTATCTTCTGACATCGCTCGATCTGCCTGTTGCATGGCGGGTGGTGGAGGCGAGCCGGGAGGTGCCGCATTTCTGTATTGCCCTTGCCATCGATAGTGAAAAGCTGCTCGATCTCATGCGCCGCATACCGATCGATCCATCT---...---TCGGAGCCGGCGAATGCGCAGCGCGGCATCGTCGTCAACAGGGCAACACCGGAACTTCTCGATGCGGCCATACGGCTCCTGCGCTTGCTTGATCGTCCAGCCGACATCGCCGCCATGGCGCCGCTGATCGAGCAGGAGATCCTCTATCGCATCCTGACCGGACCGGCCGGCGGGCAATTG
Q9I268_PSEAE/58-212 ACCGCCGTCGAACCCCTCGCCCTGATCCGCGCCGACGGCCCCACCCTGCCGGCGCGCGGCATGCACAAACCTGCCCTGTGCATCATCGCCCAGGGCCGCAAGGAGGTGCAGTTGGCCGAGGAACGCTATATCTACGATCCGTTGCACTACCTGGTGGTCTCGGTCACCCTGCCGCTGGCCGGCCAGGTGATCGACGCCTCGCCGGACGCGCCCTACCTCTGCGTCCGGCTGGATATCGACCCGGCGGAAATCACCCAGTTGATCTCCGACGCCGGGCCCATGGAA------...---GTGGCCAGCCGGCGCGGCGACCGCGGCCTCTACGTCGACCGTATCGACGCCAGCCTGCTGGATGCCGTGCTGCGCCTGATCCATCTGCTGGACAGCCCGCGCGACATCCCGATGCTGGCGCCGCTGATCCTCCGCGAGATTTTCTACCGGCTGCTGCGCAGCGGCCAGGGCCAGCGCCTG
Q88N21_PSEPK/34-188 TCGGCCATCGATGACCTGTACCTGGTGCGTTACACCGAAAATGTACGTTCTGTACCCACCCTGGCGCAGCCTGCCCTGTGCATCCTTGCCCAGGGCAGCAAAAGCCTGTTCCTGGGTGACGAGCAGTACGCCTACGACCCACTGCATTACATGGTCGTTTCGGTGACCTTGCCACTCAGCGCCGTGAGGCTGGATGCCAGCCCCGAGAACCCAAGCCTGGGCCTGCGCATGGACCTGGACCCGGCGGAGATCAGCCAACTGATCGCCGAGAGCGGGCCAATGCTGGTA---...------CCCAATCGACCTTCCGGCCGTGGTTTGTATGTGGAAAGGACAGATGCCGCGTTACTCGATGCCCTGCTGCGGTTGCTGCGGCTGCTGGACACCCCTCGCGACATCGCAATGCTGGCGCCGCTGTTCCGCCGCGAGATTCTCTACCGCCTGCTGCGTGGGCCGCAGGGTTACCGGCTG
Q8P7D5_XANCP/24-179 ACGGCCGTGCCCGGGCTGCGGCTGATGCGCTGCTCCGCGCCCACCTACTCCATCCCCACGGTGTACACGCCCACCCTGTGCCTGGTCGCGCAGGGGCACAAGCAGGCCATGCTCGGTACCACCGCGTATCACTACCATCCGGCGATGTATCTGGTGGCCTCTGTGGACCTGCCGATCATCGGCTCGGTGATCGAAGCGAGCCCGGCCCAGCCGTATCTGTGTTTTTGCCTGGATCTGGACGTGGCCGTGCTCAGCGACCTTGCGATCCGTTACCCGGCCCTGGCCGAG---...---CAGGCTGGCGACACGCCAGCGTCCGGACTGTTGCTCAATCGCAGCACGCCGGAGTTGCACGACGCCGCCTTGCGGCTGGCGCGCCTGCTCGACCAGCCGCGCGACATCGACGCGCTGGCGCCGCTGGTACTGCGCGAATTGCTGTACCGGCTGATGGCCGAACCGGGCAATGCCATCGTG
Q8PIQ6_XANAC/38-193 ACGCAGATCGCCGGGTTGCAGATCATGCGTAGCGCATCGCCGACCGTAGCCATGCCCACTGTCTACACACCCATGCTGTGCCTGGTGGCGCAAGGCCGCAAGCAGGCAATGCTCGGCGCGCAGGCGTACTTCTATCACCCGCAGATGTACCTGGTGGCGTCGGTGGATCTGCCCATCGTCGGCTCGGTAATCGAAGCCAGCGGCGCGCAACCGTATCTATGCTTCTGCCTGGACCTGGACACCGCGGTGCTCAGCGAGCTGGCGATCAACCATCCGGAACTGGTGGAC---...---ACGCAGCGCGATGCGGCATCGGCCGGGCTGTTACTCAATCGCAGCACGCCGCAGTTGCAGGACGCGGCGCTACGGCTGGCGCGCCTGCTCGATCAACCGCATGAAATTGCCGCGCTCGCGCCCTTGATCGTGCGCGAACTGCTGTACCGCCTGATGGCCGACCCGGCCAATGCGGCGGTG
Q8U6C7_AGRT5/23-177 ACGCAGCTGCCGGGGTTGAAGCTCATTCGCTGTTCCGAGACGACATTGCCGATGCCTGTCGTCTACGAGCCGACACTTTGCCTCGTCGCACAGGGGCGAAAGCAGGCGGTTCTCGGGCAGACAAGCTTTGTCTATGATCCCTCCAGCTATCTGGTCGCCTCCGTTGATCTTCCGGTCATGGGATCGGTAATCGAAGCATCGAAAGACAAACCTTATCTTTCGATGCAACTCGACCTTGACACCGTGGAGTTGGCGGATCTGGCAATTCGCTATCCTTCAGAACAGCAC---...------GCGCCAATCAACGGCCCTATCGGCCTGTTACTTAACAAGGTGGATGAGGGTATCATTGATGCCGCTTCGCGTCTCCTTGCGCTGCTGGACACGCCTCGAGATATCGACGCCCTTTCACCGCTGGCGAAGCGTGAGATATTATATCGTCTCATTACCGGTGTTGGAGGAGCGGCGTTG
Q87FG6_VIBPA/35-189 ACGCCAATTTCGGGGTTGAGGTTCAGTCGTTGGACAACGCCGACGCCGCCTACGAGCTATACCCACAATCCAAGTATTTGTCTTATCGCGCAAGGCAGGAAGCGAGTCTTATTGGGAGAGGAAAGCTTTATTTACGATGCCAACCACTTCCTGATTTCTTCTGTCGATCTCCCTATCATTGCCAACATTATCGAAGCCAGTGAGGAGCAACCTTATTTAGGGCTGATCATGGAGCTGGATTTGACCGAGATTTCCCAACTGATTGTCGATAGCGAACTTGCC---------...TTTACTCAATCCAAAGAAGCGCAAAAAGGCATTGCTGTCGGTGAGTTGTCGGAATCTCTATTGGATGCGTTTGTACGTTTAGCAGAATTATTAGACGAAGGCCAAAACATCAAAATTTTAGCGCCCATCATTAAACGGGAGATTTTTTATCGCCTTTTGATGAGTGAACAGGGCACGCGTCTC
Q9X0A0_THEMA/26-179 AGGCCACTTCCGGGTCTGACTGTGGGCAGGAGGGAGTCTCCTACAGAACCTTCCACTTACATCCTTCCGCCATCGATATGCATCGCTGTTCAGGGTGCAAAGCGCGTTCTCATTGGAGAAGAGTACTACGTTTACGACGTGGAGAATTTTCTTCTCAACTCCTTCGATGTTCCCGTCGTTGCTCAGGTGATAGAAGCTTCTAAGGAAAAACCTTATATCGGAATGACTTGGGAGATAGACATGGAGATCCTTATGGAAATCGTTGTTGAACAAAAGCTCAATACAAGA---...---------CCAATCACGTCATCCCGCGGTACATCACTGGGAAAAGTCACTCATCAGCTCCTGGACGCATTCAGAAGGATGCTGGAGCTCCTCGATGAACCGGAACACATTTCCGCACTCCTTCCCGTGATAAAAAAAGAGATCATCTATAGGCTCCTTGTGAGCGAACAGGGCCCGAGACTC
Q8Y1R4_RALSO/38-192 ACATCGATCCCCAACCTGGGGCTTTTCCGGCGGGACACTGCCGTGGAGCCGTGCGTATGCCTGGTGGAGCCCAGTGTTGTTCTGGTTGCTCAGGGCGCCAAGCAACTACAGGTGGGTGATGAGGCATACACCTATGACATTGAGCGTTTTCTGGTCACATCGCTGGATATGCCCGCCGTTTCGCGCGTATTGGATGCCAGCCCGGAGAGGCCATGCCTGGGGCTGGTGTTCAAGCTCGACTTGCGGATCACCGCGGAGCTGATCGCACAGAGCGGCCTGCCGCCACCG---...------ACCGAGCCCGCTGCAGAACGAGGCATGGCGCTGGGTACCCTCACGCCGCTCCTGCTGGAGCCGCTGAAGCGATTGGTTGATTTGCTGGACGAGCCGGAGGCCGTTCCGGTACTTGCGCCGCTCATCCAGCGTGAAATTCATTTCCGCCTGCTGATGAGTGACCAGGCGACACGCCTG
Q92WK9_RHIME/38-192 CATCCCGTTCCAGGCCTGTCGCTCTATCGCATCGTCGAGCCGGCAGGCCCCTTTTCGAGCGTATACGAGCCGAGCCTCTCCTTCATCATCAAGGGCAGCAAGAATGTCCGCGTCGGCAACGAGACGCTCGTCTACGATGAAGGCTGCTTCTTCCTGACCGCCATCGGGGTTCCCGTAACTGCGCAGATCTGCGCAGCGAGCGAAGGGGAGCCCTATGTCGCAGCCGCCTTGCGGCTGGACATGGGAAAAGTGCGGCGCATCATTGCTGATCACGACATACACCCGACC---...------GACATTCCCGAACGCGACCTTGGTGTGGCTGTCGGTACCGCGACGCGCGAGCTCTTCGACGCCCTGTTCCGGCTGATTTCGCTTGCGAGCTCGCCGGCCGACATTCCGTTCCTGGCCGGCCATATCCAGAACGAGATCCTCTATCGGCTTCTCACCGGCGAGCAGGGCGCGCGGCTG
Q880S7_PSESM/38-192 ACGTCCATTCCAGACCTCACCTTCTACCGAATGGACAAACTGGCCACGCCCACCTACTGCATTTACGAGCCCTGTGTGGCCATCATTCTGCAGGGCGCCAAGGAGATCACCTTCGGCGAGCAAGCCTGTGAGTTTGCGCAAGGGTCTTTCTTCGTCACATCGGTCGATATTCCGACGCTTGCTCGCGTTACTGCCGCCAGCGAGCAGACACCCTATTTATCCATTGTGTTGAAGCTCGATCTTTCCATGCTCAACGACGTTATCCAGACCCAGGCACCGCTGAAGCAA---...------GAGGCGACACCTGAGGCCCGAGGCTTTGCGTCTGGCATGGCATCAAGTGAAATGCTCGACGCCTTCGCTCGACTCTCCGCGTTGACCGGGCAGCCGCTGGAAGCAGGCTTGATGTCGGACCTTATCAAGCGGGAGATATGTGTTCGGTTGTTGCTGAGTTGCGCTGGCCAGTGGTTA