EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06686 alignment
(6 sequences with 189 bp)


Q8XJC9_CLOPE/3-65 GATTTATCTTTGATTTTTCAGATTGCAGGAGTTGGTATAGTGCTTGTTATACTAGATAAAGTTCTTGATCAAAGTGGTAAAAAGGAGTATGCAACTTTAGCTAATATAGTTGGAGTAGTCATAATACTTACCATGATGATTCAACTTATAAGTAGATTATTTTCTTCTGTTAAATCTATGTTTTTATTT
Q97HC1_CLOAB/3-65 GATATATCGCTTTTATTTAAAATTGCGGGAGTTGGAATTCTTACTATAATTATAGATAAAATACTTAAATCCAGTGGAAAAGATGATTTTGCAGTAGTAACAAATTTGGCAGGCATAGTGATCCTCCTCTTGATGGTAATAAGCCTAATAAGTAAATTGTTTGAGGCTGTAAAGACTATGTTTCAACTT
Q8RAD8_THETN/2-64 AACATAGACATAATCTTTAAGATTGCGGCAATAGGAATTTTAGTGACTGTTTTAAATCAAATTCTCATACGATCCGGGAGAGAAGAACAGGCTATGATGGTGACTCTAGCAGGAATAGTAGTAGTCCTCATGATGGTAATCCACCTTATAAACAATCTTTTTAACACTGTAAAGACCATATTTCATCTG
Q9K955_BACHD/4-66 GACGTAAATACCATTTTCCAAATTGCTGGTATTGGTATTGTAGTTGCCATGATTCATACAGTGTTAAAGCAAATGGGAAAAGAGGATTGGGCCCATTGGGTGACCTTGATTGGGTTTGTCGTCGTCCTTTATATGGTTGCGACGATTGTAGATGATCTCTTTCAAAAAATTCGAGGCGTCTTTCTATTT
SP3AC_BACSU/4-66 GACGTGAATGTCATATTTCAAATCGCCGGAGTGGGAATCGTGGTCGCTTTTTTACACACGATATTGGATCAGATGGGCAAGAAAGAATATGCTCAGTGGGTGACGCTGTTAGGTTTTATCTATATTTTATTTATGGTCGCCACGATTGTAGATGACCTATTTAAAAAGATAAAAGCTGTGTTTTTATTC
Q8EQ31_OCEIH/4-66 GACGCAACGATACTATTCCAAATTGCAGGAATTGGAATAATAGTAGCACTCATTCATACAATCTTGAAACAAATGGGGAAAGAAGAAATTGCTCAGTTTGCGACACTAATTGGGTTTATTATTGTTCTTGTTATTGTCGTAAATGGATTATCAGATTTATTCCAACAAATTAAATCGGTATTTTTATTC