EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06677 alignment
(2 sequences with 597 bp)


AA27_HUMAN/1-199 ATGGCCCTGAACGGAGCTGAAGTCGACGACTTCTCCTGGGAGCCCCCGACTGAGGCGGAGACGAAGGTGCTGCAGGCGCGACGGGAGCGGCAAGATCGCATCTCCCGGCTCATGGGCGACTATCTGCTGCGCGGTTACCGCATGCTGGGCGAGACGTGTGCGGACTGCGGGACGATCCTCCTCCAAGACAAACAGCGGAAAATCTACTGCGTGGCTTGTCAGGAACTCGACTCAGACGTGGATAAAGATAATCCCGCTCTGAATGCCCAGGCTGCCCTCTCCCAAGCTCGGGAGCACCAGCTGGCCTCAGCCTCAGAGCTCCCCCTGGGCTCTCGACCTGCGCCCCAGCCCCCAGTACCTCGTCCGGAGCACTGTGAGGGAGCTGCAGCAGGACTCAAGGCAGCCCAGGGGCCACCTGCTCCTGCTGTGCCTCCAAATACAGATGTCATGGCCTGCACACAGACAGCCCTCTTGCAGAAGCTGACCTGGGCCTCTGCTGAACTGGGCTCCAGCACCTCCCTGGAGACTAGCATCCAGCTGTGTGGCCTTATCCGCGCATGTGCGGAGGCCCTGCGCAGCCTGCAGCAGCTACAGCAC
AA27_MOUSE/1-199 ATGGCCTTGAACGGTGCAGATGTCGACGATTTCACCTGGGAGCCTCCGACTGAAGCTGAGACGAAGGTGCTGCAGGCGCGACGGGAGCGGCAGGATCGCATCTCCCGTCTGATGGGGGACTACCTGCTCCGTGGTTACCGCATGCTGGGCGACACGTGCGCCGACTGCGGGACGATCCTCCTGCAAGATAAACAGCGGAAAATCTACTGTGTGGCTTGTCAGGAGCTCGACTCAGACGTGGATAAAGATAACCCGGCACTGAATGCACAGGCGGCGCTCTCTCAAGCTCGGGAACACCAGCTGGCCTCATCTACAGAGCCTGCCTCGAGCTCTCGGCCCCCATCCCAGCCACCAGTACCCCGTCCAGAGCACTGTGAAGGCGCAGCAGCCGGGCTCAAGGCAGCCCAGGCGCCTCCTCTTCCGGCTGCACCTCCAAATACGGACGCGGTGGCTTCCACACAGACGGCCCTCCTGCAGAAGCTAACCTGGGCGTCAGTCGAGCTGGGCTCTAGCACCTCCTTGGAGACTAGTATCCAGCTCTGTGGGCTTATCCGGGCTTGCGCCGAGGCCCTAGGCAGCCTGAAACAGCTGGATCAC