EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06622 alignment
(2 sequences with 915 bp)


Q8VNR9_ECOLI/1-305 ATGAACCTATTGAATTCTCAATTGAATATGAAAATTAATGATTTTTACTTGCCATTGTTGTCAGTCATAGGAACCGGTCGCCTCTATATTACGCCTGAAGGGCATGCTTGCCATGCATATTTTCGCGAAGTCAGCGGTAATGGTATCCGCTTCACGTTAACATGCTCAGGCTATGAGGGGCGTTTTTGGATATCAGAAGAACAGTTCATTCAGTGGTGCCAGGAGTTATTCCCGTATAGCGAAAGCCGGCTGATACCGGAAGATATGATAAAACTCATGATCTTATGGGTAATGCAGACTGCTTTACCAGAAGGTGATGTGTCTGTTGATGATGTTCAATTTACGATGCTAAATAAAGATGTTTATCCGGTAATAGAAAATAATAATGGAGAAAACAGACTTAATGTAATTATACTCGAAATAACGGTACAGAGTTTACAATATCTAATTAATGAAAATTGGCAATTTGTTCCACATTCTAATACCATTTTCTTTGATGGATATATTGCTCCTGGGTGGACTGATTACCCGGTTACAGAGCTGACTGTTGGTGATAGTTTAAGGCTCTATCATGTTGATGACAGCAAAGAAAGAGAGTGTTGGCTTGTTATTAATAACCCTTTAGCAACCGTAAAACTTTGTGATAATAATTTATTTATTGCGGATGTCCAGGCTGCAGATTTGTTATGTACTATCAGCAATGAGGCTGTAATGGATCGCATTTATTGTGTTATTGGAACAATTCATGTTGATATACATATGTTGCGCAATGCCAAAAAAGATGATATTATCGATTCAACTGGATATCATCTTTTTGGTGGGTGCCGGTTAATACGCAATAATACGACTATAGCATACGGAAGCATTGTAAAAATCAACGAAGATTTTTATTTTACTGTTAGTTTAGTATGTGAT
Q93FK4_9ENTR/1-305 ATGAAGCCATTGAATTCTCAATCGAATATGAAAATTAATGATTTTTACTTACCATTATTACCTGTCATAGGAATCGGTCGCCTCTATATTACGTCCGAAGGGCATGCTTGCCATGCATATTTTCGTGAGGTCAGCGGTAATGGTTTTCGTTTCACGTTGGCATACTCGGGCTATGAGGGGTGTTTTTGGGTATCAGAAGAGCAGCTTACTCAGTGGTGCCATGAGTTATTCCCGTATAGCGATAGTAGATTGATTCCCGAAGATACGATAAAACTCATGCTCCTATGGGCAATACACGCAACATTACCAGAAGATGATGCGTCAGTTGATGATGTTCAATTTACGACGTTAAATAAAGATATTTATCCGGTAATAGAAAATAATAATGGTAAAAACAGACTTAATGTAATTATTCTTAAAACGACGGTACAAAGTTTACAATATCTGATTAATGATAATTGGCAATTAGTTCCGCATTCTAATACTCTTTTTTTTGATGGTTATATCGCACCTGGATGGACTGATTATCCAATTACAAAATTGAGTATTGGTGATAGTTTAAGACTCTATCATGTTGATGATAGTCAAGAGAGAAAATGTTGGCTTGTTATTAATAACCCTTTGGCAACCGTAAAGTTAAGTGATAATAATTTGTCTGTTACGGATGTTCAGGCCGCGGATCCGTTATGTATTATCAGCAACGAGACTGTAATGAATCGTATTTATTGTGCGATTGGTACAATAAATGTCGATATACATAAATTGCGGAATTTAAAAAAAGATGATACTATAGGTTCTGTCGGATATCATCTTTTCGGTGGGGGGCGGTTAATACGGAATAATACAATAATAGCATATGGAACTATTATAAAAATCAATGAGGATTTTTATTCTAATATTAGCGTAGTATGTGAT