EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06431 alignment
(3 sequences with 1275 bp)


Q9DH70_SV40/265-681 ACTAAACAAGTGTCCTGGAAGCTTGTAACAGAGTATGCAATGGAAACAAAATGTGATGATGTGTTGTTATTGCTTGGGATGTACTTGGAATTTCAGTACAGTTTTGAAATGTGTTTAAAATGTATTAAAAAAGAACAGCCCAGCCACTATAAGTACCATGAAAAGCATTATGCAAATGCTGCTATATTTGCTGACAGCAAAAACCAAAAAACCATATGCCAACAGGCTGTTGATACTGTTTTAGCTAAAAAGCGGGTTGATAGCCTACAATTAACTAGAGAACAAATGTTAACAAACAGATTTAATGATCTTTTGGATAGGATGGATATAATGTTTGGTTCTACAGGCTCTGCTGACATAGAAGAATGGATGGCTGGAGTTGCTTGGCTACACTGTTTGTTGCCCAAAATGGATTCAGTGGTGTATGACTTTTTAAAATGCATGGTGTACAACATTCCTAAAAAAAGATACTGGCTGTTTAAAGGACCAATTGATAGTGGTAAAACTACATTAGCAGCTGCTTTGCTTGAATTATGTGGGGGGAAAGCTTTAAATGTTAATTTGCCCTTGGACAGGCTGAACTTTGAGCTAGGAGTAGCTATTGACCAGTTTTTAGTAGTTTTTGAGGATGTAAAGGGCACTGGAGGGGAGTCCAGAGATTTGCCTTCAGGTCAGGGAATTAATAACCTGGACAATTTAAGGGATTATTTGGATGGCAGTGTTAAGGTAAACTTAGAAAAGAAACACCTAAATAAAAGAACTCAAATATTTCCCCCTGGAATAGTCACCATGAATGAGTACAGTGTGCCTAAAACACTGCAGGCCAGATTTGTAAAACAAATAGATTTTAGGCCCAAAGATTATTTAAAGCATTGCCTGGAACGCAGTGAGTTTTTGTTAGAAAAGAGAATAATTCAAAGTGGCATTGCTTTGCTTCTTATGTTAATTTGGTACAGACCTGTGGCTGAGTTTGCTCAAAGTATTCAGAGCAGAATTGTGGAGTGGAAAGAGAGATTGGACAAAGAGTTTAGTTTGTCAGTGTATCAAAAAATGAAGTTTAATGTGGCTATGGGAATTGGAGTTTTAGATTGGCTAAGAAACAGTGATGATGATGATGAAGACAGCCAGGAAAATGCTGATAAAAATGAAGATGGTGGGGAGAAGAACATGGAAGACTCAGGGCATGAAACAGGCATTGATTCACAGTCCCAAGGCTCA------------------TTTCAGGCCCCTCAGTCCTCACAGTCT------GTTCAT
TALA_POVBK/267-689 ACAAAGCAGGTGTCTTGGAAATTAATTACTGAGTATGCAGTAGAGACAAAGTGTGAGGATGTGTTTTTATTATTAGGTATGTATTTAGAATTTCAATACAATGTAGAGGAGTGTAAAAAGTGTCAGAAAAAAGACCAGCCTTATCACTTTAAGTATCATGAAAAGCACTTTGCAAATGCTATTATTTTTGCAGAAAGTAAAAATCAAAAAAGTATTTGTCAGCAAGCAGTAGATACAGTTTTAGCTAAAAAAAGAGTAGATACCCTTCATATGACCAGGGAAGAAATGCTAACAGAAAGATTCAATCATATATTAGATAAAATGGATTTAATATTTGGAGCTCATGGAAATGCTGTACTAGAACAATATATGGCAGGTGTTGCTTGGCTGCACTGTTTGCTACCTAAAATGGATTCTGTAATATTTGATTTTTTGCACTGTATTGTTTTCAATGTACCTAAAAGAAGATACTGGTTATTTAAAGGTCCCATTGATAGTGGAAAAACAACACTAGCTGCAGGGTTATTAGATTTGTGTGGTGGTAAAGCCTTAAATGTAAACCTACCCATGGAAAGGCTAACCTTTGAGCTAGGTGTAGCTATAGATCAGTACATGGTTGTTTTTGAAGATGTAAAAGGGACAGGAGCTGAATCAAAGGATTTGCCTTCAGGACATGGAATAAACAATTTAGACAGTTTGAGAGATTATTTAGATGGAAGTGTTAAGGTAAATTTAGAAAAGAAACATTTAAACAAAAGAACCCAAATATTTCCACCAGGCTTGGTTACAATGAATGAGTATCCTGTCCCTAAAACCCTGCAAGCTAGATTTGTAAGACAAATAGATTTTAGGCCCAAAATATATTTAAGAAAATCCTTACAAAACTCAGAGTTCTTACTTGAAAAAAGAATTTTACAAAGTGGAATGACCTTGTTGCTACTGCTAATTTGGTTTAGGCCTGTAGCTGATTTTGCAACTGATATACAATCTAGAATTGTTGAATGGAAGGAAAGGCTGGATTCTGAGATAAGTATGTATACTTTTTCAAGGATGAAATATAATATATGCATGGGGAAATGTATTCTTGATATTACAAGAGAAGAGGATTCAGAAACTGAAGACTCTGGACATGGATCAAGCACTGAATCCCAATCACAATGCTCTTCCCAAGTCTCA------GATACTTCAGCCCCTGCTGAAGATTCCCAAAGGTCAGACCCCCATAGTCAAGAGTTGCATTTGTGTAAAGGCTTTCAGTGTTTTAAAAGGCCT
Q8JUD5_POVJC/266-682 ACTAAGCAGGTTTCATGGAAATTAGTTACACAGTATGCTTTGGACACCAAGTGTGAGGATGTTTTCTTGCTTATGGGCATGTACTTAGACTTTCAGGAAAACCCACTGCAATGCAAAAAATGTGAAAAAAAGGATCAGCCAAATCACTTTAACCATCATGAAAAGCACTATTATAATGCCCAAATTTTTGCAGATAGCAAAAATCAAAAAAGCATTTGCCAGCAGGCTGTTGATACTGTAGCAGCCAAACAAAGAGTTGACAGTCTCCATATGACCAGAGAAGAAATGTTAGTTGAAAGGTTTAATTTTTTGCTTGATAAAATGGACTTAATTTTTGGGGCACATGGCAATGCTGTTTTAGAGCAATATATGGCTGGGGTTGCCTGGATTCATTGTTTGCTGCCTCAAATGGACACTGTCATTTATGAGTTCTTAAAATGCATTGTATTAAACATTCCAAAAAAAAGGTACTGGCTATTCAAGGGGCCAATAGACAGTGGCAAAACTACTTTAGCTGCAGCTTTACTTGATCTCTGTGGGGGAAAATCATTAAATGTTAATATGCCATTAGAAAGATCAAACTTTGAGTTAGGAGTGGGTATAGATCAGTTTATGGTTGTATTTGAGGATATAAAAGGCACTGGTGCAGAGTCAAGGGATTTACCTTCAGGGCATGGCATAAGCAACCTTGATTGCCTAAGAGATTACTTAGATGGAAGTGTGAAAGTTAATCTAGAGAGAAAACACCAAAACAAAAGAACACAGGTGTTTCCACCTGGAATTGTAACCATGAATGAATATTCAGTGCCTAGAACTTTACAAGCCAGATTTGTAAGGCAAATAGATTTTAGACCTAAGGCCTACCTGAGAAAATCACTAAGCTGCTCTGAATATTTACTAGAAAAAAGGATTTTGCAAAGTGGCATGACTTTGCTTTTGCTTTTAATCTGGTTTAGGCCAGTTGCTGACTTTGCAGCTGCCATTCATGAGAGGATTGTGCAGTGGAAAGAAAGGCTGGATTTAGAAATAAGCATGTATACATTTTCTACTATGAAAGCTAATGTTGGTATGGGGAGACCCATTCTTGACTTTCCTAGAGAGGAAGATTCTGAAGCAGAAGACTCTGGACATGGATCAAGCACTGAATCTCAATCACAATGCTGTTCCCAGGTCTCA------GAAGCCTCTGGTGCAGACACACAGGAACACTGCACT------------------TATCACATCTGTAAAGGCTTCCAATGTTTCGAGAAACCA