EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06395 alignment
(3 sequences with 270 bp)


Q9HF59_ASHGO/151-237 GATCCCGTGACGGAGCTGTCGAAGCTGTTCCAGCAGGGCTCGCCCCTGTGCATTATCTTTAATGCAGTCAAGCCGCACTGCAAACTTCCCGTT---------GTTTCGTCTGACGACACGAAGATATGCAAAAAGTCGATCTACGATTTTATTATGGGGCTGAAGCTGCATTTTGCGTTCAACGACGAGGAGCTGTTCACCATCTCTGATGTGTTTTCCAACTCAACTGATCACTTCACCAAGGTGCTAGACGTTGTAATTGCTCTGCTC
CDC24_YEAST/156-242 GACCCTGTGACACAACTATCACAGCTGTTTCAACAAGGTGCGCCCCTCTGTATACTTTTCAACTCTGTGAAGCCGCAATTTAAATTACCGGTA---------ATAGCATCTGACGATTTGAAAGTCTGTAAAAAATCCATTTATGACTTTATATTGGGCTGCAAGAAACACTTTGCATTTAACGATGAGGAGCTTTTCACTATATCCGACGTTTTTGCCAACTCTACTTCCCAGCTGGTCAAAGTGCTAGAAGTAGTAGAAACGCTAATG
SCD1_SCHPO/105-194 GATCCAGTTACGGAAATTTGGCTGTTTTGTCGTTTAGGTTATCCATTGTGTGCCCTGTTCAATTGCTTGCCAGTTAAGCAAAAATTGGAAGTTAATAGTTCGGTTTCTTTGGAAAATACGAACGTGTGTAAAGCTAGTTTATATCGTTTCATGCTCATGTGTAAAAATGAACTTGGACTCACAGACGCCGCCCTTTTTTCCATATCAGAAATTTATAAACCCTCGACAGCTCCACTTGTTAGAGCTCTTCAAACCATTGAACTTTTATTG