EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06175 alignment
(6 sequences with 750 bp)


Q9I2V2_PSEAE/4-199 ACCATGTTGCCCGAGATCGACCAATTCCTTGCCTGTTCCACTCCCGCCGCCTGGGTCGAGGCGGCCCTGGAGCGCCAG------GACGTCATGCTGCTGGACCACAAGGCCTGCGAGATGAAGGCCGCGGCGACGGCGATGCAACTGATCGGCAAGTACTCC---------------------------------------------------------------------------------------------------------------------------------------------------------GGCCGCCTGGACCTGGTGAACAAGATGAGCCGCCTGGCGCGCGAGGAGCTGCGCCACTTCGAGCAGGTGCTGGCGATCCTGAAGAAACGCGGTATCCGGGTGGTCAATGTCAGCGCCTCCCGCTACGCCTCGGCGCTGCGCGACCTGGTGCGCAAGCAGGAGCCGCAGCGGCTGACCGATACGCTGGTGGTCGGCGCCTTCATCGAGGCGCGTTCCTGCGAGCGCTTCGCCGCCCTGGTGCCGCACCTG---GACGCGGAGCTGGCGAAATTCTACGGCGGTTTGCTGAAGTCCGAGTCGCGGCATTTCCAGGACTACCTGAAGCTGGCCTACCAGTACGGCGACGAGGCCGACGTGGAGCGGACGATCGAGGTGGTGCGGGCCAAGGAGGCCGAGCTGATCAGCAGTCCGGACAACGAATTCCGCTTCCACAGC
Q8CX43_SHEON/3-250 CAATTATTGGCACCTGTTCATGCGTTTCTTCGCTGTGAGACGCCGCAAACTTGGATTGATGTAGCAAGAGCCTCAGCTTCGTTAGATGAACTCTTAATCGATCATTGTAATTGTGAGCTAAAAGCCGCGCAGACTGCGATGTTTTTGTTAAGGCGTTATGCCCTTAATGCTGAAAGTGGGCAATCGCTGTTGGCGTGGGCAAAACCCTACGAAGAATTTGTCTATCATAAGGATCGCGATATTGAGCAGTTTTTGGCCCGTGATGTCAAAAAGAATGAGCTGGTTGCCGTTCTACAACCTAATCAACATTTTTCCTTTGCTCAGGATCTTATTCCGCCACTTATTCGTCTAATAAAAGAAGAGTTCCATCATTTTGAACAAGTGCTTGAGTTGATGCACGCACGGCAAATTCCCTATCGCAATATTCGCGCAGGGCGTTATGCCAAGGGTATGATGAGCCATGTGACGACCCATGAGAAGAATATTCTGCGCGATAAGCTAATTGTCGGTGCTTATATTGAGGCGCGCTCCTGTGAGCGCTTTGCCAAATTAGCGCCTTATTTA---GATGCAGAATTAAGTAAGTTTTATGTGTCTTTGCTGCGCTCTGAGGCTCGTCATTTTGAGGATTATCTTAAGCTTGCACAATTGGTCTCAAGTGAG---GATATCAGCGAGCGCGTTGCTTATTTTGGCGAAAGGGAAGCCGAATTGATTATGGCGCCCGATGACGAATTTCATTTCCACAGT
Q9KQT8_VIBCH/11-254 CAACTTTTAGAACCGATTAACCATTTCCTGCAATGTCCTACACCCGACGAATGGGTTGAAGAAGCGCGCAAACCTGAAAACCTACGTGTTTTGTTGTTAGACCATTTACTATGTGAGCTGAAAGCTGGTCAATCCGCCATGTTTCTGATCCGTAAGTATGCGGTTGATAAAGAGAGTGAACTTTCGCTATTGGATTGGTTTAAACCTTATGAAGACTTTGCGTATCGCAAAATTGGAGATATCCAATCGCTCAAAGGC------------AAAAGCCAAATCTCCAAAGCGATCATTGCCAAATCGGATTCTCCTTATAGCCAAGATTTGATCGATAAAATGGTATTGCTAATCAAGGAAGAGCTACACCATTTCTATCAAGTGTTGGAAATTATGCAAGCGCGCAATGTGGAGTATGAGTCAATTCCGGCTAGCCGTTATGCCAAAAGCCTTCTAGCCCATATGAAGACTCATGAACCACAGACATTGATTGATAAGCTGATAGTAGGCGCTTATATTGAGGCTCGCTCTTGTGAGCGCTTTGCCAAACTCGCCCCCTACTTA---GATGACGAGATAGCAAAATTTTATGTTTCTCTGCTTCGCTCTGAAGCTCGCCATTATCAAGACTACTTGCAACTGGCTGAACAAATTGCGGGCTAC---GATATCTCTGAACGTGTTGCGTATTTTGGCCGAGTCGAAGCGGAGTTAATTTCCACTCCCGATAGCGATTTCAAGTTTCACAGT
MIAE_SALTY/21-264 CAAATACTCTCTCCGGTGCTTAATTTCCTGCATTGCCCGACGCCGCAGGCGTGGATTGTCCAGGCCCGCGATCCGCAAAATCTTCCTCTTCTGCTTACCGATCACCTGATCTGCGAACTGAAGGCTGCGCAAACCGCGTTGCTGTTGGTGCGTAAATATGTCGCCGATAAATCGGGCGCCGACGCGCTGCTCTCCTGGCTGCAACCTTACGAGGCGTTCGCGTTTCGTCAGGGGCCGGAGCCGGAT------------TTTGTTGCCCTGCATAAACAGATTAGCAAAAGCGCCATGCCGCAAACTGATGACCCCTGGGGACGTCAGCTTATCGACCGTATGGTGTTATTGATTAAAGAGGAGTTGCACCATTTTTGGCAGGTACGCGAGGTCATGCAGGCCAGAAACATTCCTTATGTGAAAATCACCGCCAGCCGCTACGCGAAAGGAATGTTGAAAGCGGTACGCACGCACGAACCGCTCACCTTAATTGATAAGCTGATTTGCGGGGCGTATATCGAAGCCCGCTCCTGCGAACGTTTTGCCGCTCTGGCGCCCTGGCTG---GATGAGGATTTACAGACGTTTTATCTCTCGCTTCTGCGCTCCGAAGCACGGCATTATCAGGATTACCTGGCGCTGGCGCAGCAGATTTCCGCCGAG---GACATTTCTGCGCGCGTGCGCTATTTTGGCGAGGTAGAAGCTGACCTTATCTTGTCGCCAGACCGCGAGTTTCGTTTTCATAGC
Q8YT06_ANASP/3-199 ACCCCCGTGTTACCAAAAATCAATGTACTAAAGCAAACTACGAGTGAGGCTTGGATAGAACAAGCG------ATCGCTAACTTAGATATCATATTGCTTGACCACTCCCACTGCGAACGCAAAGCGGCGGGTGTGGCTTTAAATTTTATGTTTCGCTAC---------------------------------------------------------------------------------------------------------------------------------------------------------CCATCCAATACCAAAATGGTAAGGGAATTAACGGCGATCGCCCGTGAAGAATTAGAACATTTTGAACTGGTAAATCAGTGGCTAGAACGCCGCAATATACCCCTAGCACCCCTACCCCCTCCTCCCTATGGCGCTGGCTTAAAAGCGGCTGCACGTACCAACGAACCCGAACGCTTTTTAGATTCCTTACTCGTGACTGGTTTAATCGAAGCACGAAGTCACGAACGCTTAGGCTTATTAGCTACACACTGTCCCGAACCAGAACTAGCCAAGTTTTATAAAGGTTTGATGGCCTCAGAGGCGCGACACTTTGGTACATATTGGGTTTTAGCGGATACTTACTTTGACCGGGAAATTGTTAGTCAAAGGCTCGATGAATTAGCTATTGTTGAAAGTGAGTTACTGGAAAATTTACACCCAGAACCTAGAATTCATAGT
Q8DGE6_SYNEL/14-210 ATTGAGACTCCCGTTCGCATTAAGTTCCTCCTCCAACCTACCCGTCGTGAGTGGGTAGAGCAGGCG------ATCGCTCACCTAGATACGATTTTGCTCGATCACTCCCACTGTGAGCGCAAAGCTGCTGGGGTAGCGATCAATCTCATGTTTCGCTAT---------------------------------------------------------------------------------------------------------------------------------------------------------CCTTCCCACAAACCATTGGTGAATGCCCTCACCGATATTGCCCAAGAGGAGCTCGACCACTTTCGCCAAGTCAATCAGCAATTAGAACGCCGCCACATTGCCCTTGCGCCCCTAAGTCCGCCCCCCTATGCCTCTCGCTTGAATGCAGCTGTCCGCCAACAGGAACCCCAGCGCCTCTTGGATCGCCTATTGGTCTGTGCCTTGATTGAAGCCCGCAGCCATGAGCGGTTGCAACTGTTGGCTCAGCACTGCCCAGAGGGCGAACTAGCGGCGTTCTTTGCGAGCCTAGTGACCTCTGAGGCACGCCACTATGGCACCTATTGGTCCTTGGCCTATGGCTCCTTTGGTCAAGAGGTAGTGGCAGAGCGATTACAGCAGTTAGCTGCTCTTGAAAGTGAAATTCTCAGCACCCCCTATCCCTTGCCGCGGATGCACAGT