EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06039 alignment
(15 sequences with 1482 bp)


MQO_BACHD/4-492 ATACAGAACAAAACAGACGTTATCTTGATTGGTGCCGGAATTATGAGTGCGACTTTGGGATCATTGTTGAAAGAGTTAAAACCCGAATGGGAAATCAAAGTGTTTGAGAAACTCGCGAACGCAGGGGAAGAGAGCTCGAATGAATGGAATAATGCGGGTACGGGGCATGCTGCGCTGTGCGAACTTAATTATACAGCAGAAAAATCGGACGGAACCATTGATATTAGCAAGGCGGTTAAAATTAATGAGCAGTTTCAAATTTCAAGACAGTTTTGGGCTTATCTCGTAAGCCAAAATTTAATCTCCAATCCGCAAGATTTTATTATGCCTATTCCTCATATGAGCTTAGTGCAAGGGGAAGACAACGTTGCTTATCTGAAAAAGAGATTTAAAGCGCTATCAAACATTCCATTGTTTGAAGGGATGGAATTTTCGAATGACCCTGAAAAACTGAAGGAATGGATTCCACTTGTTATGGAAGGTCGTACGTCCAATGAGCCAATCGCCGCCACGAAAATTGACTCGGGGACCGATGTCAACTTTGGCGCTTTGACACGCATGTTGTTTGAGCACTTAAAGGAGCAA---AATGTAGAAGTCCACTACAAGCATAGTGTAAAGGACATTAAACGTACGAGTGACGGCTCGTGGAGTGTGAAAGTTCAGGAAATTGAAAGCGGTACGATCGAA...TACCATACGGCCAATTTTGTTTTTATTGGCGGAGGGGGTGGAAGTCTGCCTTTACTCCAAAAAACAGGTATTCCTGAATCAAAAAATATCGGCGGCTTCCCGGTAAGTGGGCTCTTTATGGTCTGTAATAACCCGGAAGTGGTCGAGCAGCATCATGCGAAGGTGTACGGAAAAGCGAAGGTAGGCGCCCCACCTATGTCTGTACCGCATCTTGATACAAGATATATTGATAACAAAAAATCGTTGCTGTTCGGGCCATTTGCCGGGTTCTCACCAAAGTTCTTAAAAACGGGCTCCAATTTTGACTTGATCGGTTCTGTAAAGCCGTATAATGTTTTCACGATGCTGGCGGCAGGTGCAAAAGAGATGTCCTTAACCAAATACTTGATTCAGCAAGTGATGTTGTCAAAGGAAAAGCGTATGGCCGAACTGCGGGAGTTCATGCCAAACGCCAAGAGCGAGGATTGGGATATCGTCGTCGCAGGCCAACGGGTGCAAGTCATTAAAGATACAGAA...GCAGGTGGAAAAGGAACCCTTCAATTTGGTACGGAAGTTGTCAGTAGCGCGGATGGTTCGATTGCTGCATTGCTTGGGGCATCTCCGGGAGCTTCAACTGCTGTCCACGTCATGCTTGAAGTATTAGAAAAATGCTTCCCGCACCATATGCTA------GAGTGGCAGCCGAAAATCAAAGAAATGATTCCTTCGTATGGCGTGTCACTTGCGGAAAACCGTGAGCTGTTCCAAGAGATTCACCAGTCCACTGCGGAGGCGCTTGGCCTG
MQO_OCEIH/4-492 AAACACACGCAAGCAGACGTTATCTTAATTGGTGCTGGCATAATGAGTGCTACATTAGGATCACTTCTGAAAGAACTATCACCAAACTTAGAAATTAGAGTATTTGAGAAGCTCGAAAATCCTGGAGAAGAAAGCTCCAATGAATGGAATAATGCTGGTACAGGGCATTCAGCATTATGTGAGCTTAATTATACTTCCGAAAGAACAGATGGATCTATTGATATCAATAAAGCGGTTAAGGTCAATGAACAATTTCAACTATCAAGACAGTTTTGGTCTTACCTTGTAAATCGTAACTTGATTCGTAATCCCGAAGACTTTATCAGAGCGTTACCACATATAAGCTTAGTACAAGGTGAGGATAATGTTACATTCCTTAGAAAGCGCTTTAAGGCATTAGTGAATCATCCATTATTTAATGGTATGGAGTTCTCCGATGATAACGAAAAGTTAAAAGAGTGGATGCCGCTTATTATGGATAAACGAGATACAAATGAACCTATTGCAGCGACAAAGATTGATTCTGGTACAGATGTTAATTTCGGTGCTTTAACGCGTCTTTTGTTTCAAGAGTTTGATCATAAA---GGCATTGATGTGAATTACAATCATAGTGTAGAAGATATTAAACGAAATAGTGAAGGATTATGGGAAGTAAAAGTTCATGATATGAACGATGAAAAGATTGAA...TACCATACTGCTAAATTCGTCTTCATCGGTGCTGGTGGTGGAAGTTTGCCATTACTTCAAAAAACAGGTATCAAGGAATCGAAACATATTGGTGGCTTCCCTGTTAGTGGTTTATTTATGGTATGTAATAATCCGGAAGTAATCGAGCAGCACCATGCGAAGGTCTATGGGAAAGCTAAAGTTGGTGCACCACCGATGTCTGTTCCGCATCTCGATACGAGGTTTATTGACGGGAAAAAATCGTTACTATTTGGACCTTTTGCCGGTTTTTCACCAAAATTTTTAAAAACAGGTTCATTATTTGATTTAATGCATTCTGTGAAATCGGATAATCTTTTTACCATGCTTTCTGCTGGTATGAAGGAATTACCGTTAACAAAATATCTCATTCAACAGGTTGTCCTATCGAATGAAAAACGTATGGAAGAATTACGTGAATTCATTCCTAATGCACAAAGTAAAGATTGGGATATTGTTATAGCAGGACAGCGTGTCCAAGTAATCAAGGATACGGAA...GATGGAGGAAAAGGTACACTACAATTTGGTACGGAAGTTGTTTGTGGTGAGGATGGAACCATGGCAGCACTATTAGGCGCTTCCCCAGGGGCATCTACCGCAGTACATGTGATGCTAGAAGTGATACAAAAATGTTTCCCTGAGCATTTGCAA------GAGTGGGAACCAAAAATTAAAGAAATGATACCTTCTTATGGCATAGCACTTTCTGAAAATCCAGAGTTATATAAAGAGATTGAGGTATCTATCGAAAAGGCACTTGGTTTA
MQO1_STAEP/7-494 CAACATAGCAAAACAGATGTCATCTTAATAGGTGGCGGAATTATGAGCGCAACATTAGGAACTTTACTAAAAGAATTAACACCAGAAAAAGATATCCAATTGTTCGAAAGATTGAGTCAACCTGGCGAAGAAAGTTCAAATGTTTGGAATAATGCGGGAACAGGTCATTCAGCATTGTGTGAATTGAACTATACGAAAGAAGGTAAAGATGGTTCAGTAGATATTACTAAAGCAATTCATATCAACGAGCAATTTCAATTATCTAAACAGTTTTGGGCTTATTTAATACGTGAAGGTCATATTGAAAGTCCAGATAAATTTATTCAATCAGTGCCACATATGAGCTTTGTTAAAGGGGAAGAAAATGTTAAATTTTTAAAAAGTCGAGTGGCGAGTTTACAGAAAAATGTATTATTTGAAAAAATGAAAATTTCTCAAGATCCAGAAAAAATTAACTCATGGGTTCCTTTAATGATGGAAGGACGCCAATCAGATGAAGCAATTGCCATCACGTATGACGAGACAGGTACAGATGTTAACTTTGGTGCTTTGACTAAAAAGTTAATAGCTAATTTACAACAAAAA---AATGTTGGCATTAATTATAAACATGAAGTTTTAGATATAAAAAAATTAAATAATGGTAACTGGCAAGTTGTGGTTAAAGATTTAAATACATCAAATGTAATG...AATTATGAATCTAAGTTCGTCTTCATCGGAGCTGGTGGTGCAAGTTTACCTTTATTACAAAAAACAAAGATTAAGGAATCTAAACACATTGGTGGTTTCCCAGTAAGTGGCTTATTTTTACGATGTAAAAATCCAGATGTCATACATAGACATCATGCAAAAGTCTACGGTAAAGCCGAGGTTGGTGCACCTCCAATGTCAGTTCCACATTTAGATACACGATTTGTTAATGGTGAAAAATCATTACTATTTGGACCTTTTGCAGGGTTTTCGCCAAAATTCTTAAAAAACGGTTCATATTTAGATTTAGTTAAATCTGTGAAACCCAATAATATGATTACAATGTTAAGTGCTGGCGTAAAAGAATTTAATTTGACGAAATATTTAGTTTCTCAATTAATGCTTTCAAATGAAGAACGGATCAATGATTTGCGTGTATTCTTACCAGAAGCGAAAGATGAAGATTGGGAAGTAATTACTGCAGGTCAACGTGTTCAAGTAATTAAAGATACAGAT...AAGTCTAAA---GGTCAATTACAATTTGGTACGGAAGTGATAACATCAGAAGATGGTTCACTTGCTGCATTATTAGGTGCTTCACCTGGTGCTTCGACTGCTGTTGATATCATGTTTGATGTCTTGCAACGTTGTTACAAATCAGAGTTTAAG------TCATGGGAACCAAAAATTAAAGAAATGGTCCCATCATTTGGTTTAAAATTGTCAGAGCATGAAGATATGTACCATTCAATAAACGAAGAAGTAAAAAAATACTTGAATGTA
MQO3_STAEP/5-494 GAAGCAAATCATAAAAACATCGTTGTTGTAGGTGCAGGAATTATTGGTACGTCAGTAGCGACAATGCTTTCAAAAGTAAGTCCTAACTGGCATATCGATATGTTTGAAAGACTAGAAGGCGCTGGTATTGAAAGTTCAAATGAAAATAATAATGCTGGGACAGGCCATGCGGCATTATGTGAATTAAACTATACAGTTGAACAAGATGATGGTTCAATTGATGCATCTAAAGCGCAAGAAATTAATGAACAATTCGAATTATCTAGACAATTCTGGGGTAATTTAGTTAAAAATGGTGATATTTCTAATCCTGAAGAATTTATCCAACCATTACCTCATATCAGTTTCGTTATGGGACCAACAAACGTTAACTTTTTAAGAAAACGTTATGAAACACTAAAAACACTTCCAATGTTCGATACAATCGAATATACAGAAGACATGGAAACAATGAGAAAATGGATGCCATTAATGATGGAAAATCGTGAACCAGGTCATCAAATGGCAGCAAGTAAAATTGATGAAGGTACAGATGTGAACTATGGTGCGTTAACACGTAAGTTAGCACATTACTTAGAACAAAAATCTAATGTTTCATTAAAATACAATCATGATGTTGTAGATTTAACACAAAGAGAAGATGGCAAATGGGAAGTTGTCGTTGAAAATAGAGAAACTAAAGAAAAAGTA...ACTAAAATAGCAGATAAAGTGTTTATTGGTGCTGGCGGTCACTCTATTCCGTTATTACAAAAATCTGGCGTTAAACAAAGAGAACACCTAGGTGGTTTCCCAATCAGTGGTCAATTCTTAAGATGTACAAACCCAGATATTATTAAACAACATGCGGCTAAAGTTTACAGTAAAGAGCCTCAAGGTAAGCCACCAATGACTGTACCACACCTTGATACACGTTATATCAATGGTAAACAAACATTATTATTTGGTCCATATGCGAATATCGGCCCTAAATTCTTGAAATTCGGTTCAAATCTAGACTTATTCGAATCAATCAAACCATATAACATTACTACAATGTTGGCTTCAGCAGTTAAAAATGTACCTTTAATTAAATATTCAATTGATCAAATGATCAAAACTAAAGAAGGTTGTATGAACTATTTAAGAACATTTATTCCTGATGCTAAAGATGAAGATTGGGAACTTTACACTGCTGGTAAACGCGTTCAAGTTATTAAAGATAGTGAA...CAACACGGTAAAGGTTTCGTAGTATTTGGTACTGAAGTTGTCAATTCAGACGACAATTCTATGATTGCATTATTAGGTGAATCTCCAGGGGCTTCAACATCATTATCAGTTGTATTAGAAGTTTTAGAGAAAAACTTCGCTGATGACAAAGAA------GCATGGGAACCTGTTGTTAAAGAAATGGTACCAACATACGGTCGTTCATTAATTAATGACGAAAAATTAATGAGAGAAACACGCCGTGAAACTTCTAAAAACTTACATTTA
MQO4_STAEP/3-492 ATGTCTGACAAAAAAGACGTCGTGTTAATCGGTGCTGGTGTACTAAGTACTACATTTGGTTCTATGTTGAAAACGATTGCACCTGATTGGGACATTCATTTATATGAACGTCTAGATCGTCCTGGTATTGAAAGTTCAAATGAACGTAACAATGCAGGAACAGGACATGCAGCTTTATGTGAATTGAACTATACTGTACAACAACCTGATGGTTCAATTGATATTGAAAAAGCTAAAGAAATTAATGAACAATTTGAAATTTCTAAACAATTCTGGGGTCATTTAGTTAAATCAGGAGAAATTCAAAATCCTAAAGAATTTATTAATCCATTACCTCATATTAGTTTTGTTCGTGGTAAAAATAACGTTAAATTCTTAAAAGATCGTTATGAAGCGATGAAGCAATTCCCTATGTTCGATAATATCGAATATACTGAAGATATTGAAGAAATGAGAAAATGGATTCCATTAATGATGAAAGGCCGTGAAGATAAGGGCTACATGGCAGCGAGTAAAATAGACGAAGGAACTGACGTAAACTACGGTGAATTAACTCGTAAAATGGCTCAAAATCTTAAAAACTCACCAAACGTTGAAGTGCAATACAAACATGAAGTTGTTGATTTTGAACGTTTGTCTAATGGTAAATGGTCAGTTAAAATTAAAAATCTAAATAATGGACAAGTATTC...GAACATCAAACTGATTATGTGTTTATCGGTGCTGGTGGTGGCGCAATTCCATTATTACAAAAAACTGGCATTCCAGAAAGTAAACATTTAGGTGGATTCCCAATCAGTGGTCAATTTATTGCTTGTACAAATCCGCAAGTTATTGAACAACACGATGCCAAAGTTTATGGTAAAGAACCACCTGGTACACCACCAATGACGGTACCTCACTTAGATACACGTTACATTGATGGTGAAAGAACATTATTATTTGGACCATTTGCAAACGTGGGACCTAAATTCCTAAAACATGGTTCTAACTTGGATTTATTCAAATCAATTAAACCATATAACATTACGACTTTACTTGCTTCTGCAGTTAAAAACTTACCATTAATTAAGTATTCATTTGACCAAGTCATCATGACAAAAGAAGGTTGTATGAACCATTTACGTACGTTCTATCCTGAAGCACGTGATGAAGATTGGCAAGTTTATACAGCTGGTAAACGTGTACAAGTTATTAAAGATACTGAA...GAGAATGGTAAAGGATTTATCCAATTTGGTACTGAAGTGGTTAATTCTGAAGACCACTCAGTTATTGCATTACTAGGCGAATCACCAGGAGCATCAACTTCAGTATCAGTAGCACTAGAAGTTTTAGAGAAAAACTTCCCTGAATACGCGAAA------GACTGGGAACCTAAAATCAAGAAAATGATTCCTTCATATGGTGAATCACTTATTGATGATGTTCAATTAATGAGAAAAATACGTAAACAAACATCTAAAGATCTTGAATTA
MQO_PSEFL/6-494 GCAGTCGATGTAGTTCATGTAGTTCTGGTAGGGGCCGGCATCATGAGTGCCACCCTGGCCGTACTGCTCAAGGAGCTCGACCCCGCGATCTCGCTGGAAGTCGTCGAGCTGATGGATTCCGGTGCCGCGGAGAGTTCCAACCCGTGGAACAACGCCGGTACCGGCCACGCCGGGCTGTGTGAGCTCAACTACACGCCCCAGGCAGCCGACGGCAATGTCGACATCAAGAAGGCCGTGCACATCAACACCCAGTTCGAGGTGTCGAAGCAGTTCTGGACGTACCTGACCAGAAAAGGCACGTTCGGCTCCTCCAAGTCCTTCATCGCCCCGGTGCCACACCTGAGCTTCGTGCAAGGCGAGAAAGGCGTGTCGTTCCTGAAGAAGCGCTTCGAGCTGATGCACCAGCATCACGCCTTCGCCGACATGGAATACACCGAGGACAAGGCCCGGATGGCCGAGTGGATGCCGCTGATGATGCCTGGTCGGCCGGCCGATGAGGTTATCGCCGCCACCCGTGTCATGAACGGTACCGACGTCAACTTCGGCGCCCTGACCAACCAGTTGCTCAAGCACCTGACCAGCGCCCCGGACACCCAGGTCAAATACTGCAAGCGCGTCACCGGCCTCAAGCGTAACGGCAGTGGC---TGGACCGTGAGCATCAAGGACGTCAATTCCGGCAGCAGCCGC...GATGTCGACGCCAAGTTCGTGTTCCTGGGTGCCGCCGGTGCGGCGTTGCCGTTGCTGCAAGCCTCGGGCATCGAGGAAAGCAAGGGCTTCGGCGGCTTCCCGGTCAGTGGCCAGTGGCTGCGTTGCGACAACCCGGAAGTGGTCAAGCACCACCAGGCCAAGGTCTACAGCCAGGCCGCCGTGGGCTCGCCGCCGATGTCGGTGCCGCACCTGACACCCGTGTGGTCGATGGCAAGAAATCCCTGCTTGTTCGGGCCATACGCCGGTTTCACCACCAAGTTCCTCAAGCACGGCTCGATCATGGACCTGCCGCTGTCGGTACGTGCCGGCAACATCGGCCCGATGCTGGCCGTGGCCCGGGACAACATGGACCTGACCAAGTACCTGATCAGCGAAGTGATGCAGTCCATGGAACAGCGCCTGGAATCCCTGCGTCGCTTCTACCCCGAGGCAAAGGCCGAGGACTGGCGCCTGGAAGTGGCCGGCCAGCGGGTGCAGATCATCAAGAAAGACCCG...AAGAAAGGT---GGCGTCCTGCAGTTCGGTACCGAACTGGTGGCGGCCAAGGACGGCAGCCTCGCCGCCCTGCTCGGCGCATCGCCGGGTGCTTCGGTGACCGTGTCGATCATGCTGGAACTGATCGAGCGTTGCTTCCCGGACAAAGCCAAGGGC---GAGTGGGCTACCAAGCTCGCAGAGATCTTCCCGGCCCGGGAAAAAGTGCTGGAAACCGACGCGGCGCTGTATCGCAAGATCAATGCGCAGAACAACATCGCGCTGGAGCTG
MQO2_PSEAE/5-494 GATCACGAAACAGTCGACATGCTGCTGGTAGGCGCCGGCATCATGAGCGCGACCCTGGCGGTCCTGCTCAAGGAACTCGACCCCAACCTGAAGATGGAAGTCGTCGAACTCCAGGAGTCCGGCGCGATCGAAAGCTCCAACCCGTGGAACAACGCGGGCACCGGCCACGCCGGCCTGTGCGAACTGAACTACACCCCGCAGTCGGCCGACGGCAGCATCGACATCAAGAAAGCCGTGGGCATCAACACCATGTTCGAGGTGTCGAAGCAGTTCTGGTCGCACCTGGTCGCCAAGGGCACCTTCGGCTCGCCGAAGACCTTCATCAACCCGGTACCGCATCTGAGCTTCGTGCGCGGCAGCGAAGGCATCGCCTACCTGAAGAAGCGCTTCGAATCGCTGACGAAGCACCACGCTTTCGAGACCATGGTCTACTCCGAGGACAAGGCCACCCTCGCCGAGTGGATGCCGCTGATGATGCCGGGTCGTCCGGCCGACGAAGCGATCGCCGCGACCCGCGTCGAGGGCGGTACCGACGTCAACTTCGGCGCCCTGACCAACCAGCTCCTGCAACACCTGGCGCAACAGCCGGGCGCGCAGATCCGCTACAACCAGAAGGTCACCCACCTGCGCCGCGCCGATAACGGC---TGGCGGGTCACCGTCAAGGACACCCGCAACGGCGGCGACCGC...GAGATCCAGGCACGCTTCGTCTTCCTCGGCGCCGGCGGCGGCGCCCTGCCGCTCCTGCAACTTTCCGGCATCCCGGAAGGCAAGGGCTTCGGTGGTTTCCCGGTGAGCGGCCAGTGGCTGCGCTGCGACAACCCGGAAATCGTCAAGCAGCACCAGGCCAAGGTCTACAGCCAGGCCGAGGTCGGCTCGCCGCCGATGTCCGTGCCGCACCTGGACACCCGTGTGGTGGACGGCAAGAAATCCCTGCTGTTCGGCCCCTATGCCGGTTTCTCCACCAAGTTCCTGCGCCATGGCTCGTTCCTCGACCTGCCGCTGTCGGTACGCCCGGGCAACATCCTGCCGATGCTCTCGGTGGCCCGCGACAACATGGACCTGACCCGCTACCTGATCGGCCAGGTCATGCAATCGCCGGAACAGCGCCTGGAAGCCCTGCGCAAGTTCTACCCCGAAGCCAGAGCCGAGGACTGGCGCCTGGAAGTCGCCGGCCAGCGCGTGCAGATCATCAAGAAGGATCCG...AAGAAAGGC---GGCATCCTGCAGTTCGGCACCGAGCTGGTGGCCGCCCACGACGGCTCCATCGCCGCCCTGCTGGGCGCCTCGCCGGGCGCCTCGGTGACCGTCTCGATCATGCTCGGCCTGATCGAGCGCTGCTTCCCGGAGCAGGCCCGCTCGCCGGAGTGGAGCGCCAAGCTGAAGGAAATCTTCCCGGCTCGCGAGAAAGAGCTGGAAAGCGACGCCGAGCTGTACCGCAGCGTCAGCAGCCGTTGCAGCGAGGTGCTGGAACTG
MQO_XYLFA/37-526 AACGACACCCCAGTAGACGTCGTACTTATCGGTGGCGGCATCATGAGCGTCACCCTTGGCACCTATTTACAGGAACTTCAACCAGATTGGAAAATCGAGTTGTTCGAACGCCTGAACGGCATCGCACAGGAAAGCTCGGACGGCTGGAACAACGCCGGCACAGGTCATTCCGCATTCGCCGAACTAAATTACACACCAGAACTGCAAGATGGCACCATCGAAATCAAACGCGCCATCAAGATCGCCGAACAATTCGAGATATCACGCGAATTCTGGTCCCATCAGGTCCGTCATGGCCGCTTGCCCGCACCCACAGAGTTCATCAACGCGACCCCGCACATGAGCTTCGTCTGGGGTGAAGACCGGATCGAATACCTGCGCAAGCGTCACAACGCCCTCATCAAGAACCCCCTGTTCTACGGAATGCAGTTCTCTACCGACCCAGCGGTCATCCAACAGTGGGCGCCACTGCTGATGGAAGGTCGGACACAGGATCAGAAAATCGCTGCAACCTACATGCCGCTAGGCACTGACGTTAACTTCGGCGTCATTACCCGGGATCTTGCCAAGCATCTGCAATACAGCCAAAACTTTGCACTGCACCTGGACCATGAAGTCACCGCACTGCGCCAAAACCCCGACAAAACATGGAACGTGACTGTCAAAAACCTCAACAATGGCCAAGAACGC...AGCATCAAATCACGCTTTGTGTTTATTGGAGCCGGTGGCGCTGCACTGAAACTGCTGCAACTGTCCGGGATCCCAGAATCCAAAGACTATGCAGGCTTTCCGGTCGGCGGCCAGTTCCTGTCCTTCGAAAACACAGCCATCACTAAGCGCCACAACGTCAAAGCCTATGGCATGGCTGAGTCCGGCTCGCCGCCGATGTCGGTACCTCACCTGGACGCCCGAAAACTCGACGGTAAATCCATCGTTCTCTTTGGACCGTTCGCACTTTACAGCACCAAATTCCTGAAAAAAGGCTCTTGGTTCGACCTCTACTCATCAGTCAACCATCACAACGCCGCCGGCATGCTGAGCGTCGGCAAAAATAATATTGACCTTGTGAAATACCTGATGAAACAGGCCACACTCACCGATGCAGACCGCCATGCCGAACTTTTGAAATACTTCCCCAACGCCAAACCAACAGACTGGACACTCGTCACGGCCGGCCAACGTGTACAAATCATCAAACGCGATCCG...GAGAAGGGC---ATGATTCTGCAATTCGGTACTGAAATCGTGATGGATAAAGACCACACACTCGCTACCCTGCTAGGAGCCTCTCCCGGCGCATCAACCTCCCCCTCAATTATGCTGGATCTGCTGGCCAAAGCATTTCCGCAACAAATGAAAAAT---GGCTGGGAAACGCAGTTGAAGAAGATCATTCCTTCCTATGGACAACACATCAACGACAGCCCGGCACTGACCAACAAAATTCGACGAATGACCAGTGAAACGCTGTCACTG
MQO1_PSEAE/23-514 TCGGAAAAACCGGTCGACGTGCTCCTGATCGGTGGCGGCATCATGAGCGCCACCCTGGGTACCTATCTGAACGAACTGGAACCAGGCTGGACCATCGAGATGGTCGAGCGCCTGGACAAGGTCGCCGAAGAAAGCTCCAACGGCTGGAACAACGCGGGCACCGGTCACTCGGCGTTCTGCGAACTGAACTACACCAGCGAGGCCGCGGACGGCTCGATGGATATCAGCAAGGCGGTGGCGATCAACGAGAACTTCGAGATCTCCAAGCAGTTCTGGGCCTACCAGGTCGACCGCAAGGTGCTGAACGATCCGAAGTCGTTCATCAACAACGTCCCGCACATGAGCTTCGTCTGGGGCGACGACAACGTCGCCTTCCTCAAGAAGCGCCACGCCGCCCTGCAGCACAGCTCGCTGTTCCGCGGCATGGAGTACTCGGAAGACCCCGAGCAGATCAAGCAGTGGGTGCCGCTGGTGATGGAAGGCCGCGAGCCGGGGCAGAAGATCGCCGCCACGCGCATGTCGATCGGCACCGACGTCAACTTCGGCGAGATCACTCGCCAACTGGTGGGCTCGCTGTCGGCCAAGGACACCTTCAAGCTGCGCCTGCAACATGAGGTCCGCGACCTCAAGCGCAACGACGACAACACCTGGACCGTGACCATGGCCGACCTGGCCAATGGCGACAAGGAAaccAGCGTCAAGGCCAGGTTCGTCTTCATCGGCGCCGGCGGCGGCGCGCTGAAGCTGCTGCAGATGTCCGGCATCCCCGAGGCCGAAGGCTACGCCGGCTTCCCGGTGGGCGGTTCGTTCCTCGCCACCACCAACCCGGACGTGGTCAAGCGCCACCTGGCCAAGGTCTACGGAAAGGCTTCGGTGGGTTCGCCGCCGATGTCGGTGCCGCACCTCGACACCCGCATGATCGACGGCAAGCCGGTTCTGCTGTTCGGTCCGTTCGCCACTTTCTCCACCAAGTTCCTGAAGAACGGCTCGCTGTGGGACCTGCCGGGCTCGGTGACCAGCGGCAACATCGGCCCGATGTTCAACGCCGGCATCGACAACTTCGATCTCAGCCAGTACCTGATCGGCCAGCTGATGCTCAGCCAGGACGACCGCATGGCCTCGCTGCGCGAGTACTTCCCGGAAGCCCGCGACGAGGACTGGAAGCTGGTGCAGGCCGGCCAGCGCGTGCAGATCATCAAGAAGGACGCC...GAGAAAGGC---GGCGTACTGCAATTCGGCACCGAAGTGGTGACCGCAGCGGACGGCTCCGTCGCCGCCCTGCTCGGCGCCTCGCCGGGCGCCTCGACCGCCGCGCCGATCATGCTGTCGGTGCTGGAGAAGGCCTTCAAGGACAAGGTCGCTACCCCCGAGTGGCAGGCACGCCTGAAGGAAATCGTGCCGTCTTACGGGCGCAAGCTGAACAACGACATCGAGCTGACCAACAGCACCCGTGCCTGGAGCAGCGAGCGCCTGCAACTG
MQO_ECOLI/28-518 GAGGAGCAGGAAACTGATGTACTGTTGATTGGCGGCGGCATTATGAGCGCCACGTTGGGGACCTATTTACGCGAGCTGGAGCCTGAATGGTCGATGACCATGGTGGAGCGCCTGGAGGGTGTCGCGCAGGAGAGTTCGAACGGCTGGAATAACGCCGGAACCGGGCATTCTGCACTGATGGAACTGAACTACACCCCGCAAAACGCCGATGGCAGCATCAGTATTGAAAAAGCAGTCGCCATTAACGAAGCATTTCAGATTTCCCGCCAGTTCTGGGCGCACCAGGTTGAGCGCGGCGTGCTGCGTACTCCGCGTTCATTTATCAATACCGTTCCGCATATGAGCTTTGTCTGGGGCGAGGATAACGTCAATTTCCTGCGCGCCCGTTACGCCGCGTTGCAACAAAGCTCGCTGTTTCGCGGTATGCGTTACTCTGAAGATCACGCGCAGATCAAAGAGTGGGCACCGTTAGTGATGGAAGGGCGCGATCCGCAACAGAAAGTGGCAGCCACGCGTACGGAAATTGGTACCGATGTGAACTACGGCGAGATCACCCGCCAGTTAATTGCTTCCTTGCAGAAGAAATCTAACTTCTCGCTGCAACTCAGCAGCGAAGTCCGCGCCCTAAAGCGTAATGACGATAACACCTGGACCGTTACCGTTGCCGATCTGAAAAATGGCACTGCACAG...AACATTCGTGCCAAATTTGTCTTTATCGGCGCGGGCGGTGCGGCGCTGAAGCTGTTACAGGAATCGGGGATTCCGGAAGCGAAAGACTACGCCGGTTTCCCGGTGGGCGGACAGTTCCTTGTTTCGGAAAACCCGGACGTGGTTAATCACCATCTGGCGAAGGTTTACGGTAAAGCATCCGTTGGCGCACCACCGATGTCGGTTCCGCATATCGATACCCGCGTTCTGGACGGTAAACGCGTAGTGCTGTTTGGGCCATTTGCCACCTTCTCAACCAAATTCCTCAAAAACGGTTCATTGTGGGATCTAATGAGTTCCACCACCACCTCTAACGTGATGCCGATGATGCACGTCGGGCTGGATAATTTCGATCTGGTGAAATATCTGGTGAGTCAGGTGATGTTGAGTGAAGAGGATCGTTTTGAAGCGTTGAAAGAGTACTATCCGCAGGCGAAAAAAGAGGACTGGCGTTTGTGGCAAGCGGGGCAGCGCGTGCAGATTATCAAGCGTGATGCC...GAGAAAGGT---GGCGTACTGCGTCTGGGTACTGAAGTCGTCAGTGACCAGCAAGGAACCATTGCCGCGCTCCTGGGGGCATCGCCAGGGGCGTCAACCGCCGCGCCGATTATGTTGAATCTGCTGGAAAAAGTATTTGGCGATCGTGTTTCCAGCCCGCAATGGCAGGCTACGTTGAAAGCGATCGTTCCGTCTTATGGACGCAAGCTGAACGGTGATGTAGCGGCAACAGAACGCGAGTTGCAGTACACCAGCGAAGTGCTGGGGTTG
MQO_RALSO/13-503 GAGACGAAGAAGGTGGATGTGCTGCTGGTGGGCGGCGGCATCATGAGTTCGACGCTCGGCGTCTGGCTGCATGAGCTGGAGCCCGACTGGTCGATGATGATGGTCGAGCGCCTGGACGGCGTCGCCCAGGAAAGCTCGAACGGCTGGAACAACGCCGGCACCGGGCACTCCGCGCTGGCCGAACTGAACTACACCCCCGAAAAATCGAACGGCAAGATCGACATCTCCAAGGCCGTCGAGATCAACGAAGGCTTCCAGGTAACGCGCCAGTTCTGGACGTACCAGGTCAAGACCGGCGTGCTCAAGAACCCGCGCTCGTTCATCAATTCGACCCCGCACATGAGCTTCGTGTGGGGCGAGGACAACGTCCGCTACCTGAAGAAGCGCTACGAGGCGCTGCAGGCCAGCCCGCTGTTCCGCGGCATGCAGTTCTCTGACGACTATGACCAGATCAGCAAGTGGGTGCCGCTGATGATGGAAGGCCGCGACCGCTCGCAGAAGGTCGCCGCCACCTGGATGCCGGTGGGCACCGACGTGAACTTCGGCGAGATCACGCGCCAGTTCGTCGGCTACCTGCAGAGCCAGCCTCAGTTCACGCTGTCGCTGTCGAGCGAAGTGCGCGACATCAAGCGCAATGACGACGGCACGTGGCGGGTGTCGTACGTCAACCTGAAGTCGGGCGACCGGCAG...GATGTCGACACGAAGTTCCTCTTCATCGGCGCGGGCGGCGGCGCATTGCGCCTGCTGCAGGCTTCGGGCATTCCGGAAGCGCGCGACTTCGCCGCTTTCCCGGTCGGCGGCTCGTTCCTGGTCACCGAGAATCCGGAAGTCGTGAACCGCCACCTGGCGAAGGCGTACGGCAAGGCTTCGGTCGGCTCGCCGCCGATGTCGGTGCCGCACCTGGATACCCGCGTCATCGACGGCAAGCGGATCATCCTGTTCGGCCCGTTCGCGACGTTCTCGACGAAGTTCCTGAAGAACGGTTCGTACATGGACCTGTTCGGCAGCACCACCTCGCACAACGTCATGCCGATGCTGCATGTGGGCGTCGACGAGTTCCCGCTGGTCCAGTACCTGGCGGGCCAGCTGATGCTGTCCGACGAAGACCGCTTCAATGCGCTGAAGGAATACTTCCCGCTTGCGAAGAAGGAAGACTGGCGCCTGTGGCAGGCCGGCCAGCGCGTGCAGATCATCCAGCGCGACGAG...GCCAAGGGC---GGCATCCTCAAGCTCGGCACGCAGATCGTGAAGTCGAAGGACGGCACCATCGCCGGCCTGCTCGGCGCATCGCCGGGCGCATCGACCGCGGCCCCGATCATGCTGGGCGTGCTCGAGACGGTGTTCAAGGACAAGCTCGCCACGCCGGCCTGGCAGCAGAAGGTCCGCCAGATGATCCCGACCTACGGCATCAAGCTCAACGACAACCCGGCCAAGGTCTACGAGGAATGGGTTGCCACCGCGGAAGCGCTGCAGCTG
MQO_WIGBR/20-510 GAAAATGATTCAGTAGATGTTGTATTAATTGGAAGCGGAATTATGAGTGCTACTTTGGGTATATATTTAAAGTTACTAGAACCAAATTGGATTATTCATTCTTATGAAAGACTGAACAAAGTGGGACAAGAAAGTTCTAATGCATGGAATAATGCAGGAACAGGACATTCTGCTTTTTGTGAATTAAATTATACATCTATAAATAAAGATGGATCTATTAACATATCGAAAGCAATTAAAGTAAATGAATCATTTGAAATTTCTAAACAATTATGGGCTTATTTAATCAAGGAAAAAATTTTAGTAAATTCAAGTTCTTTTATTAATACAGTTCCTCATATGAGTTTTGTATGGGGAGAAAATAATATAAATTTTCTTAAAAAGAGATTTTTTTATTTAAAACAGAACGCGCTTTTTAAAGACATGTTATATTCAGAAAATTACGATATAATAAAAAAATGGGCTCCATTAATAATGGAAGGTAGAAGCATTAATGAAAAAGTAGCGGCTACAAGAATGGAAATAGGAACAGATGTAAATTTTGGAGAAATCACTAAACAGATATTTTATTATTTGAAAAATAAATCAAATTTTTTCTTATATTTGAACCACGATGTAATTGATATTATAAGAAATAAAGATAAAACTTGGTGTTTAAAGGTTGTTGATAATATTTTAAAAAAAACAATA...AAAATAAATTCTAAATATGTATTTATTGGATCAGGAGGAGGTGCATTAAAATTACTTCAGAAATCTAAAATAGAACAATCAATTGGATACGCAGGATTTCCTGTAGGAGGTCAATTTTTAGTAACTAAAAATAAAAAATTAACAAATAATCATCAGGCAAAAGTATATGGAAAGTCTCCTATAGGAGCACCTCCGATGTCTGTTCCACATATAGATACTAGAATAATTAATGGAGAAAAAGTATTATTATTTGGTCCATTTGCCACATTTAGCAGTAAATTTTTAAAAAATGGATCTTATTTTGATTTATTTTCTTCTTTAACAAAAGAAAATATTATACCAATTTTACAAGTTGGAATAAACAACTTCAATTTAGTTAAGTATTTAATTAATCAATTATTGAAATCTAAACGTGGCAAATTTAATGATTTATGCAAATATTTGCCAACAGCAAAAATGAAGGACTGGAGTTTAATTACTGCTGGACAAAGAGTGCAAATTATAAAAAAAGATATC...GAAAAAGGC---GGTATTTTAGAATTTGGAACTGAAATTATAAATTCTAAAGATTGTACTTTATCTGCATTATTAGGAGCTTCTCCAGGAGCTTCTACATCAGCTTCAACAATGTTAGATTTATTAAAAATTATGTTTTATGACAAAATAAATAAATCAGAATGGAAATCCAAATTAAACAAAATATTCATTTCATACAATAAAAAAATACATGAAAGCTATGAATATACATTAGAAATAAGAAATTATACATCAAAAATATTAAGTTTA
MQO_NEIMA/1-488 ATGGCTGAAGCGACAGACGTTGTCTTGGTGGGCGGCGGCATTATGAGCGCGACTTTGGGCGTTTTGCTCAAAGAACTCGAACCGTCTTGGGAAATCACCCTGATTGAACGCTTGGAAGATGTGGCGTTGGAATCGTCAAACGCGTGGAACAACGCCGGCACGGGGCATTCCGCGCTGTGCGAATTGAACTATGCGCCGTTGGGTGCAAATGGGATTATCGATCCGGCGCGCGCCCTCAATATTGCCGAACAGTTTCATGTCAGCCGCCAGTTTTGGGCGACGTTGGTCGCGGAAGGCAAGTTGGAAGAC---AATTCCTTCATCAATGCCGTGCCGCATATGTCTTTGGTGATGAATGAAGACCATTGTTCTTATCTTCAAAAACGTTATGACGCGTTTAAAACCCAAAAACTTTTTGAAAATATGGAATTTTCCACCGATCGGAACAAAATTTCCGATTGGGCTCCGCTGATGATGCGCGGCCGGGACGAAAACCAACCCGTCGCCGCCAACTACTCCGCCGAAGGCACGGATGTCGATTTCGGACGGCTGACGCGCCAAATGGTGAAATATTTGCAGGGCAAG---GGCGTAAAAACCGAGTTCAACCGCCACGTCGAAGACATCAAACGCGAATCCGACGGCGCGTGGGTGCTCAAAACCGCCGATACCCGCAACCCCGACGGGCAGctcACCCTCCGTACCCGCTTCCTCTTCCTCGGCGCGGGCGGCGGCGCGCTGACCCTGCTGCAAAAATCCGGCATCCCCGAAGGCAAAGGCTACGGTGGCTTTCCCGTGTCCGGCCTGTTCTTCCGCAACAGCAACCCCGAAACCGCCGAACAACACAACGCCAAAGTGTACGGGCAGGCTTCCGTCGGCGCGCCGCCGATGTCCGTCCCGCACCTCGACACACGCAACGTGGACGGCAAACGCCACCTTATGTTCGGCCCTTACGCAGGCTTCCGTTCCAACTTCCTCAAGCAAGGCTCACTTATGGATTTGCCGCTGTCCATCCATATGGACAACCTCTATCCTATGCTGCGCGCCGGCTGGGCGAATATGCCGCTGACCAAATACCTGCTGGGCGAATTGCGTAAAACCAAAGAAGAACGCTTCGCCTCCCTGCTGGAATACTACCCCGAGGCAAACCCCGACGACTGGGAACTCATCACCGCAGGGCAACGCGTTCAAATCATTAAAAAAGACTCC...GAAAAAGGC---GGCGTGTTGCAGTTTGGTACGGAGATTGTCGCACACGCCGACGGCTCGCTCGCCGCATTGCTGGGCGCGTCGCCGGGCGCATCGACCGCCGTGCCGCTGATGATCCGGCTGATGCACCAATGCTTCCCCGAACGCACC------CCGTCTTGGGAAGGCCGTCTGAAAGAGCTGGTACCGGGTTACGGCATCAAGTTGAACGAAAACCCCGAAAGGGCGGATGAAATTATCGCCTATACCGCGAAAGTGTTGGATATT
MQO_CORGL/10-496 ATTACCGATGAGGCAGATGTAGTTCTCATTGGTGCCGGTATCATGAGCTCCACGCTGGGTGCAATGCTGCGTCAGCTGGAGCCAAGCTGGACTCAGATCGTCTTCGAGCGTTTGGATGGACCGGCACAAGAGTCGTCCTCCCCGTGGAACAATGCAGGAACCGGCCACTCTGCTCTATGCGAGCTGAACTACACCCCAGAGGTT---AAGGGCAAGGTTGAAATTGCCAAGGCTGTAGGAATCAACGAGAAGTTCCAGGTTTCCCGTCAGTTCTGGTCTCACCTCGTTGAAGAGGGAGTGCTGTCTGATCCTAAGGAATTCATCAACCCTGTTCCTCACGTATCTTTCGGCCAGGGCGCAGATCAGGTTGCATACATCAAGGCTCGCTACGAAGCTTTGAAGGATCACCCACTCTTCCAGGGCATGACCTACGCTGACGATGAAGCTACCTTCACCGAGAAGCTGCCTTTGATGGCAAAGGGCCGTGACTTCTCTGATCCAGTAGCAATCTCTTGGATCGATGAAGGCACCGACATCAACTACGGTGCTCAGACCAAGCAGTACCTGGATGCAGCTGAAGTTGAA---GGCACTGAAATCCGCTATGGCCACGAAGTCAAGAGCATCAAGGCT---GATGGCGCAAAGTGGATCGTGACCGTCAAGAACGTACACACTGGCGACACCAAG...ACCATCAAGGCAAACTTCGTGTTCGTCGGCGCAGGCGGATACGCACTGGATCTGCTTCGCAGCGCAGGCATCCCACAGGTCAAGGGCTTCGCTGGATTCCCAGTATCCGGCCTGTGGCTTCGTTGCACCAACGAGGAACTGATCGAGCAGCACGCAGCCAAGGTATATGGCAAGGCATCTGTTGGCGCTCCTCCAATGTCTGTTCCTCACCTTGACACCCGCGTTATCGAGGGTGAAAAGGGTCTGCTCTTTGGACCTTACGGTGGCTGGACCCCTAAGTTCTTGAAGGAAGGCTCCTACCTGGACCTGTTCAAGTCCATCCGCCCAGACAACATTCCTTCCTACCTTGGCGTTGCTGCTCAGGAATTTGATCTGACCAAGTACCTTGTCACTGAAGTTCTCAAGGACCAGGACAAGCGTATGGATGCTCTTCGCGAGTACATGCCAGAGGCACAAAACGGCGATTGGGAGACCATCGTTGCCGGACAGCGTGTTCAGGTTATTAAGCCTGCAGGAttcCCTAAGTTC---GGTTCCCTGGAATTCGGCACCACCTTGATCAACAACTCCGAAGGCACCATCGCCGGATTGCTCGGTGCTTCCCCTGGAGCATCCATCGCACCTTCCGCAATGATCGAGCTGCTTGAGCGTTGCTTCGGTGACCGCATGATC------GAGTGGGGCGACAAGCTGAAGGACATGATCCCTTCCTACGGCAAGAAGCTTGCTTCCGAGCCAGCACTGTTTGAGCAGCAGTGGGCACGCACCCAGAAGACCCTGAAGCTT
MQO_MYCTU/3-490 GACCTAGCCAGAACCGACGTCGTGCTGATCGGTGCGGGCATCATGAGCGCCACGCTGGGGGTGCTGCTGCGTCGGCTCGAACCGAACTGGTCAATCACCCTGATCGAACGGCTGGACGCGGTAGCCGCCGAAAGCAGCGGTCCCTGGAACAACGCCGGCACCGGGCACTCCGCGCTGTGCGAGATGAACTACACCCCAGAAATGCCGGACGGCTCGATCGACATCACCAAAGCGGTGCGTGTCAACGAGCAATTCCAGGTCACCCGCCAGTTCTGGGCATACGCGGCCGAAAACGGCATCCTCACCGACGTGCGCAGCTTCCTCAACCCTGTGCCGCACGTGAGTTTCGTCCATGGATCGCGGGGCGTCGAGTATCTACGGCGCCGCCAAAAGGCGTTGGCCGGCAACCCGCTGTTCGCCGGCACCGAGTTCATCGAGAGTCCCGACGAATTCGCCCGCCGGCTGCCGTTCATGGCCGCTAAACGGGCCTTCTCCGAGCCGGTGGCGCTCAACTGGGCCGCCGACGGCACCGACGTCGACTTCGGTGCCCTCGCCAAACAACTCATCGGCTATTGCGTGCAAAAT---GGCACTACCGCGTTGTTCGGGCACGAGGTTCGCAACCTCTCGCGGCAATCCGACGGCAGCTGGACGGTCACCATGTGCAACCGCCGGACCGGCGAAAAGCGC...AAGTTGAACACCAAGTTCGTCTTTGTCGGGGCCGGGGGTGACACCTTGCCGGTGCTGCAGAAATCCGGGATCAAAGAGGTCAAAGGCTTCGCCGGCTTCCCGATTGGCGGTCGGTTCCTGCGCGCCGGGAACCCGGCGCTCACCGCCTCGCATCGGGCAAAGGTATATGGCTTCCCGGCGCCGGGCGCCCCGCCGTTGGGCGCCTTGCATCTGGATCTGCGGTTTGTCAACGGCAAGTCGTGGCTGGTGTTCGGGCCATACGCCGGCTGGTCGCCGAAGTTCTTGAAACACGGGCAGATCAGCGACCTGCCCCGGTCGATCAGGCCGGACAATCTGTTGTCCGTGCTCGGCGTGGGCCTCACCGAGCGGAGACTGCTGAACTACTTGATCAGCCAGCTGCGTCTCTCTGAACCCGAGCGGGTCAGTGCGCTGCGCGAATTCGCCCCTAGCGCAATCGATTCGGACTGGGAGTTGACGATAGCCGGTCAGCGGGTACAGGTGATCCGGCGAGATGAA...CGCAACGGC---GGGGTGCTCGAGTTCGGCACGACGGTCATCGGCGATGCTGACGGTAGTATTGCCGGACTACTGGGCGGCTCCCCAGGGGCTTCGACCGCGGTGGCGATCATGCTGGACGTGCTGCAGAAATGCTTTGCCAACCGCTATCAA------TCCTGGCTGCCCACGCTCAAAGAAATGGTGCCGTCGCTGGGGGTGCAGCTGTCGAATGAACCCGCGCTGTTCGACGAGGTGTGGTCATGGAGCACCAAGGCGCTGAAGTTA