EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05992 alignment
(5 sequences with 408 bp)


SBMA_ECOLI/34-169 TGGGTGGCGCGTATCACCGGCGCTTCCGGGCAGATCCCGATTAGCGCCGCGCGTTTCTGGTCGTTGGATTTCCTGATTTTTTACGCTTACTACATTGTTTGCGTAGGACTTTTTGCATTGTTCTGGTTTATCTACAGCCCGCATCGTTGGCAATACTGGTCAATACTCGGTACTGCACTGATCATCTTCGTCACCTGGTTTTTGGTGGAAGTCGGGGTCGCCGTCAACGCCTGGTATGCGCCGTTCTATGATCTGATTCAAACCGCGCTAAGTTCGCCGCATAAAGTCACCATCGAACAATTTTACCGCGAAGTGGGCGTCTTTCTGGGGATTGCGCTGATCGCTGTGGTGATCAGTGTGCTGAACAACTTCTTTGTCAGTCACTACGTGTTCCGCTGGCGTACAGCG
Q8G2F1_BRUSU/38-173 TTCGGCCTTGCGCCAGCCGCAAGCGATGCCGCGCCTCTCATTGGCGCGCATGTGTTCTGGTCGCGGCCCTTCCTCTGGTTCTATATTTATTTCGCCGTCATTACCTTCGCCTTTTATGGCTTCTGGGTGCGTTTTTCCCCACATCCCTGGCAGAGATGGTCAATCCTCGGTTCTGCCCTCATTCTGTTCGCCACCTATTTCAACGTTCAGGTGAGTGTGGCAATCAATACTTGGTATGGCCCGTTCTACGATATGGTGCAGAAGGGGCTGACGACGCCCGGCGCGGTCTCGGCTGCGGAATTCTACTGGGGGCTGGCCGATTTTGCAGGCATTGCTTTCCTCGCCATCACCATTGGCGTGCTGAACCTCTTCTTCGTCAGCCATTATATCTTCCGCTGGCGCACGGCG
BACA_RHIME/38-173 CTGGGCTTGCCGCCGCTTCCTCCAGGACAGGAACCCGTCATCGGCGTGTCCGTTTTCTGGTCCACCCCTTTTCTTTGGTTTTACATCTATTATGCGGTGGTCGCAGGGCTATTCGCAGCGTTCTGGTTCGCCTACAGCCCGCATCGGTGGCAGTATTGGTCGGTACTCGGCACGGCGCTGATCATTTTCAATACCTATTTTTCGGTTCAGGTCAGCGTCGCGATCAACGCGTGGTACGGCCCTTTCTATGATTTGATCCAGCAGGCGCTGGCGCGTACGGCGCCGGTCACAGCAGGGCAGCTCTATTCGGGAATGATCGGATTTTCGGGAATAGCCTTCGTGGCGGTGACGGTCGGTGTGCTCAACCTCTTTTTCGTCAGCCATTACATCTTTCGCTGGCGCACGGCG
Q986E2_RHILO/38-173 TTCGGCCTGCCAGCCGCCGCCGCTGACGCTCCGCCCATCATCGGCATCGCTGTTCTCGTGTCGAAGCCGTTCCTCTGGTTCTACATCTATTTCGTGGCCTGCGTGGCCATCTTCTACGCATTCTGGAGCTGGTATTCGCCGCATCCGTGGCAGCGCTGGTCGATCCTGATGACGGCGGTTATCCTGTTCTTCATCTATTTCAATGTGCAGGTCAGCGTCGCCGTCAACGCCTGGTACGGGCCCTTCTTCGACTATGTGCAGGGGCTGATGTCAGGGACCGGAAAATCGACCAACGGTGAATTTTATACCGGGCTGGCCGACTTTTCCTGGCTCGCGCTGGTCGGCATGAATGTGCAGGTGGTCAATGCCTTTATCGTCAGCCATTGGATCTTCCGCTGGCGCACGGCG
Q9AN93_BRAJA/2-120 GCTTCGCGAGCAATCTGTTCGAAGCGCCGCAAAAGGCAGGTCGGGTTGGCGACGTTCTCGTCGGCGCCGGCTCTCTGGTTCGACCTCTATTTCGCCGCGTGCGCCGCGATATTTGCGGCTGGCTGGATGTTGGTTGCGCCGCACCCCTGGGCGACGTGGTCGATTCTTGGCTCCGCGCTAATACTGTTCACCTCCTACTTTCAGGTCCAGGTCAGCGTCGCCATCAACAGCTGGTATGGGCCATTCTATGACCTTGTCCAGGCCGCGCTTTCGAAATCGGCGCAAGTGATGGTCCAGCAGTTCTACAGCGAGTTGTCGACTTTTGCCGGCATTGCTCTTGTTGCGGTCGTG---------------------------------------------------TCGGTG