EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05955 alignment
(2 sequences with 2271 bp)


VGLZ_EHV1K/1-383 ATGGGGTTCATCTATGCGCGCAAACTGTTGCTGTGCATGGCTGTTAGTATATACGCCATAGGGTCCACTACAACAACTGAGACTACCACCTCTAGCTCGTCCACGTCTGGGAGTGGCCAGTCTACATCCAGTGGGACCACTAATAGTAGCAGTTCTCCCACCACGAGTCCACCTACCACATCTTCATCTCCCCCCACATCAACCCACACATCCTCCCCATCCACCGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACGCTCAAAAACACGCAGGGCAC---------CACAGAGGTCGCGCAGGGGGTCGTCGGGGTAGCCCTCAGGGGGGGTCACACACAACACCACACCCAGACCGTTTGACTCCTTCTCCAGAC---GACACCTATGACGATGATACAAATCACCCTAACGGTAGGAACAATTCAATAGAGATCGTGCCTCAGCTCCCGCCAGACCGACCCATCATAGAGCTGGGGGTGGCGACTCTCAGAAAAAACTTTATGGAGGCGTCCTGTACTGTGGAGACTAACTCAGACTTGGCGATTTTTTGGAAAATCGGCAAGCCAAGCGTAGACGCGTTTAATCGGGGAACTACTCACACTCGGCTGATGCGCAATGGGGTACCGGTTTACGCCCTCGTATCTACGCTTAGAGTTCCGTGGTTAAATGTTATTCCACTAACAAAAATTACTTGCGCTGCTTGCCCCACGAATCTAGTCGCCGGCGATGGGGTGGACCTCAACTCATGTACCACCAAATCAACCACAATACCGTGTCCGGGCCAACAGCGCACCCATATTTTTTTCTCTGCGAAAGGGGACAGGGCTGTGTGTATCACATCAGAACTGGTGTCCCAGCCCACAATAACTTGGTCAGTTGGATCAGATAGGTTGCGTAACGATGGATTTTCTCAGACGTGGTATGGAATACAGCCCGGGGTGTGTGGTATACTGCGCAGCGAGGTTCGCATTCACCGCACCACCTGGCGCTTTGGATCAACATCAAAGGACTATCTCTGTGAGGTCAGCGCATCGGACTCAAAGACGAGCGATTACAAAGTGCTACCCAACGCCCACTCAACTTCCAACTTCGCTTTAGTGGCTGCGACCACGCTAACAGTGACAATTTTATGCCTGCTGTGCTGCTTGTACTGTATGTTAACCCGCCCCCGAGCGTCTGTATAT
O39307_9ALPH/1-750 ATGGGGTTCATCTATGTTAGCAGAATACTGCTATGCCTGGCAGTTGGTATTTATGCCATAGGGGCAACAACCGCG---GAAACTACTACCGCTAGCTCGTCAACTTCTGGAAGTACCCAGTCCGCGTCTAGC---GAAACTAATAGTAGTAGTTCCCCCACCACGGGCCCCACTACCACATCTTCCCAAACATCCTCTTCTAACTCTACCCAAACACCTTCAACGTCTCAAACACCCACTACTAGCTCGTCTACCGTTTCCACAACTACTACTTCAAACTCAACAAACGAAAGTTCTACTGCGACGGCTACATCAACTGCAACTCCAACATCCACAGAAGCTTCTACGTCAACAACTACATCAACCTCGGTGTCCGAATCACCAACATCAACCACAGCTACCACAGCTGCTACTACCACAACTGAATCCACCACAACTGAATCCACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACTACCACAGCTGCTACGCCAACAGAGTCAAGCGAGGCATCTTCCACATTAGCGGCCACCACAGCTGACACCACAGCTGACACCACAGCTGACACCACAGCTGACACCACAGCTGACACCACAGCTGACACCACAGCTGACACCACAGCTGACACCACAACTACTTCAGGGTCCACCGCAGCTAACACAACCTCTACCACATCGGCCACTGTAACAATAGCTCCAACAACATTTACGACTAAGTATACCACAAATTCTTCGTCTACCGGGAAAATAAACACCTCCAAAAATACACCAAAACCCCCACAATATACTACAGCTTCCACGGAGAAACCAACTAAGGCGAATTCTTTAACAGCGGCGAACGCAACGGGCTTATCCACCAAACCCCCAACTTTATTCACGCCCACACAAACAAGCCCAACACCTAGCGAAACGTCTGTGGGTACCAGAGAGTACTTGGCAATCACCTATGGAAAAACTACATATACAACTCCCACTAATGCCCTAAGTTCAACTAATGTTTGGCCTGCCAGAGATAATAGTTCAACTCAACAAACAACCCAACATGACTACATAGTAACTACCCAAAAACTTACGGGACATTTACACCAGCACAAGGGCCGCGCAAATGGTAAAAACGTCAATAATAAG------TCTCACCCATCAGTGCGACCAGATAGGTTAACGCCACACACGGATTACCACTATTACTACGATGATACCGATTACCCA------CAGGACGGTTCATTTGAGCGTGTAACCCCACCCCCACAAGGCCAACCAAACATAGAGCTGGGTGTGGCTACGCTTAGAAAAAACTTTTTGGTGGCAACGTGTACCGTGGAGGCTACTATGGGCTTGTCATTTTTTTGGAAAATTGGCAACGCCAGCGTTGACGCGTTTAGCAGGGGAACAACGCATACGCGAGTGATGCGCAATGGGTCACCTGTTTATGCGCTAATATCTACGCTAAAAATTCCGTGGGTTAATGTGATTCCATTAACCGAGATTACTTGCGCTGCGTGTAAAGACAATTTTATT---GGCAATGAAGCTGATCTCACCTCGTGCACCGTTAAATCAACCACAATACCATGTCCAGGCCAACAACGCACCCATATTTTCTTTTCTATGAAGGGGGACAGAGCTGTTTGTATTACATCAGAACTTGCGTCCCCACCAACTATAACATGGTCGGTTGGATCAAACAGGTTGCACAACAATGGATTTACGCAAACGTGGTATGAAATACAACCTGGAGTGTGTGGAATATTGCGTAGCGAGGTCCACATTAGCCGCCCGTCTTGGCGCGTTGGTGCCCCAACGCGCGATTATCTTTGCGAAGCCACAGTATCAGATGCAAAGACGAGTGATTACAAGGTTTTACCTAACGCTTACTCGACTTCCAACTTCGCTTTAGTGGCTGCGACCACGCTAACAGTAACAATTTTATGTTTGCTGTGCTGCTTGTACTGTATGTTAACACGCCCCCGGGCGTCCGTATAT