EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05686 alignment
(5 sequences with 1317 bp)


Q9LML4_ARATH/110-503 ACCCATCAACCACAATGCCCAGACTTCTTCAGGTGGATTCACCGGGATTTAGAGCCGTGGGCAAAGACTGGGGTGACTAAAGAGCACGTGAAGAGGGCAAAAGCGAATGCTGCGTTTCGAGTGGTGATACTATCAGGGAAGTTATACGTGGATCTCTATTACGCATGTGTGCAGAGCAGAATGATGTTCACCATTTGGGGGATTCTGCAACTGCTCACCAAGTATCCAGGGATGGTTCCTGATGTCGACATGATGTTTGATTGTATGGACAAACCCATCATCAACCAGACCGAGTACCAGTCC------------------------TTTCCTGTTCCGCTTTTTCGATATTGCACCAACGAAGCTCATTTGGACATTCCTTTTCCGGATTGGTCGTTTTGGGGATGGTCGGAGACAAATCTAAGGCCCTGGGAAGAAGAGTTTGGGGATATAAAGCAAGGGTCTAGGAGAAGAAGTTGGTACAACAAGCAACCTAGAGCTTACTGGAAAGGCAATCCCGATGTTGTATCGCCTATACGACTGGAGCTCATGAAATGCAACCATTCAAGGTTA------TGGGGAGCACAGATTATGCGCCAGGACTGGGCAGAAGAAGCAAAAGGTGGGTTTGAGCAATCCAAGCTTTCCAACCAATGCAATCAC---------------------------------------------------------------------------------CGGTACAAAATCTATGCAGAAGGTTATGCGTGGTCAGTTTCTCTAAAGTATATCTTATCATGTGGTTCCATGACACTCATAATATCACCTGAGTATGAAGATTTCTTCAGTAGAGGCCTCCTTCCCAAGGAAAATTACTGGCCTATCTCTCCCACTGATCTATGTCGGTCCATCAAATACGCTGTTGATTGGGGAAATTCCAACCCCTCTGAAGCTGAAACAATTGGAAAAAGAGGACAGGGTTATATG---GAAAGCCTTAGCATGAACCGGGTTTATGACTATATGTTTCATCTCATCACTGAGTACTCGAAACTTCAGAAGTTCAAGCCAGAGAAGCCGGCTTCCGCTAATGAAGTCTGTGCAGGATCATTGCTCTGCATTGCAGAACAAAAA---------------GAGCGGGAACTACTCGAAAGATCCAGAGTCGTA---CCTTCTCTGGATCAACCATGTAAATTTCCAGTAGAA---GATAGGAATAGGCTTGAGTGGTTGATCCAACAGAAGAATAAAACAATCGAAAATGTTAGATACATGGAGATGACAAGAACACAG
Q9M2D5_ARATH/39-445 TCTTCCTTGGAAACTTGTCCTGACTACTTCAGATGGATCCAACAAGACCTAAAAGTATGGGAAGAGACAGGGATCACAAGGGAAACACTAGAGAGAGCAAAACCAAAGGCTCATTTCAGGCTAGTGATAAAGTCAGGGAGATTGTACGTTCATCAGTACGACAAGGCTTATGAGTCAAGAGATGTGCTCACAATCTGGGGGATACTTCAACTTTTAAGAATGTATCCTGGTCAAGTCCCTGATCTTGAGCTTCTCTTCTTCTGTCATGATATACCAGCTATTTGGAAACGAGACTTTAGG---CAACCGGAACCAAATGCCACGTGGCCTCCTCCGCCGTTGTTTCAGTACTGTGGTCACCGTGAAGCCTACGGCATCGTTTTCCCTGATTGGAGCTTCTGGGGCTGGCCGGAGGTGAATATAAAGGAGTGGACAAAATTATCTGTGGCGATTAGAGAAGCCAACAAAAGGGTTAAATGGAACGATAGAGTTCCATATGCTTACTGGAAAGGGAACTCTGGGGTTCATCGC---GAAAGAGGAAACCTTATGAAATGTAACTTCTCCGATAAGTATGATCCCATGGTTCGTCTCTATGAGCAGGATTGGGGGAAGGAGAGGGAGATAGGGTTTAAAAGTTCAAACCTAGAAGACCAATGCACCCAT---------------------------------------------------------------------------------AGGTACAAGATCTACATAGAAGGTCGAGCATGGTCGGTGAGCAAAAAATACATACTAGCATGCGACAGTATGACTCTACTGATCAAAGCCGAGTACTTCGATTTCTTCGGAAGAAGTTTGGTTCCGTTAGAACATTACTGGCCCATTAAATCTCACGAGAAATGTGGTGATCTCAAGTTCGCCGTGGAATGGGGTAACAACAACACTAAGAAGGCGCAAGTTATAGGGAGACAGGGAAGTGATTACATTATGAAGAACCTAGAGATGAAGTATGTGTATGATTACATGTTGTATGTGTTGCAAGGGTACGGGAAACTAATGAAGTTGGATGTGACTGTGCCTGAAAATGCAACCGAAGTGTGTTCGGAGACGATGGCTTGTCCGATCACTGACGGT---------GGCCTGATCAGGCAGTGCATGGACGACTCATTGGTTATGTCTCCAAGCGTTAAATCGGCTTGTGATTTGCCGCGGCCTTATAGAGATGATGAGCTGAAGAGGTTTCTTGAGAAACAAGAAAGTGCGGAGAGAAAGGTTGAGAAGTGGACCAATGAGTATTGGGAG
Q9SH28_ARATH/165-602 GAATCTAACCGGTCTTGTCCTGATTACTTCAAGTGGATTCACGAGGATCTAAAACCATGGAGAGAAACAGGGATAACAAAAGAAATGGTGGAAAGAGGCAAAACTACAGCACATTTCAGGTTAGTTATTTTAAACGGCAAGGTGTTCGTCGAAAACTACAAGAAGTCTATACAAACTAGAGATGCGTTCACACTATGGGGGATTCTTCAGCTGCTGAGAAAGTATCCAGGGAAGTTACCTGACGTGGATCTCATGTTTGACTGTGATGATCGACCAGTCATTAGATCGGACGGTTATAATATATTGAATCGTACGGTTGAGAAT---GCGCCACCTCCGTTGTTTAGATATTGCGGTGATAGGTGGACGGTGGATATCGTCTTTCCTGATTGGTCATTCTGGGGATGGCAGGAGATAAACATAAGGGAGTGGAGCAAAGTGTTGAAAGAAATGGAAGAAGGAAAGAAGAAGAAGAAATTTATGGAAAGAGACGCCTATGCATATTGGAAAGGGAACCCTTTTGTTGCATCTCCTTCAAGAGAAGATCTCCTCACTTGCAATTTATCCTCACTACATGATTGGAATGCTAGAATTTTCATTCAGGTATGCTTCTATAATCAGATTTATTTATACTTGTCTTCCTATGCAATATATATATATATATATATATATATATATATTTTTGATTTGTATTTGCATGCAAATAGGATTGGATATCAGAAGGACAAAGAGGATTTGAGAATTCGAATGTACAAGATCTATATAGAAGGGTATGCGTGGTCAGTGAGTGAGAAATACATATTAGCATGTGACTCAGTCACATTGATGGTGAAACCTTATTACTATGATTTCTTCTCAAGAACTCTTCAACCTCTCCAACACTATTGGCCCATTAGGGATAAAGATAAATGTAGATCCATCAAATTTGCTGTTGATTGGCTTAATAATCACACTCAAAAGGCTCAAGAGATAGGAAGAGAAGCAAGTGAGTTCATGCAAAGAGATCTATCAATGGAAAATGTTTATGATTACATGTTCCATCTGTTGAATGAATACTCCAAGCTTCTTAAGTACAAGCCTCAAGTTCCAAAGAATAGTGTTGAGCTATGCACAGAAGCCTTGGTGTGCCCTTCTGAAGGGGAAGATGTTAATGGGGTTGATAAGAAATTTATGATAGGCTCTTTAGTTAGTAGGCCTCATGCTTCTGGCCCATGTTCACTTCCTCCTCCTTTTGATTCCAATGGTCTTGAGAAGTTCCATAGGAAGAAATTGAATCTCATCCGGCAAGTGGAGAAATGGGAAGACTCTTACTGGCAA
Q9SMT6_ARATH/131-532 TCTCCATCCGCCACGTGCCCAGATTACTTCCGATGGATTCACGAGGATCTACGGCCATGGGAGAAGACCGGGATCACGAGGGAAGCCTTGGAGCGAGCCAATGCGACGGCGATTTTCCGCCTGGCGATTATCAACGGGAGAATCTACGTCGAGAAATTTCGTGAGGCTTTTCAGACAAGAGATGTGTTCACGATCTGGGGATTCGTACAGCTCCTACGGAGATATCCGGGAAAGATTCCGGATCTCGAGCTCATGTTTGACTGCGTTGACTGGCCGGTAGTGAAGGCGGCTGAATTCGCCGGAGTTGATCAACCT------------CCACCGCCGCCATTGTTCCGTTATTGCGCGAACGACGAGACGCTCGACATTGTATTTCCCGATTGGTCCTATTGGGGATGGGCTGAGGTGAATATAAAGCCATGGGAAAGTCTGTTGAAAGAACTAAGAGAAGGAAACCAGAGGACTAAATGGATAGATAGAGAGCCTTATGCTTACTGGAAAGGGAATCCAACGGTTGCTGAG---ACGAGACTTGATCTCATGAAATGTAATCTCTCCGAGGTGTATGACTGGAAAGCTCGTTTGTACAAGCAGGACTGGGTCAAGGAATCAAAGGAAGGTTACAAGCAGTCAGACTTGGCGAGCCAATGCCATCAC---------------------------------------------------------------------------------AGGTACAAGATTTACATAGAAGGGTCTGCGTGGTCGGTGAGTGAGAAGTACATTCTGGCTTGTGACTCGGTGACATTAATGGTGAAACCTCATTACTACGATTTCTTCACAAGAGGTATGTTTCCAGGTCACCATTACTGGCCTGTCAAGGAGGACGACAAATGCCGTTCCATCAAATTCGCTGTTGATTGGGGCAACTTGCATATGCGAAAGGCACAAGACATAGGTAAGAAGGCAAGTGAGTTTGTGCAACAAGAACTCAAGATGGACTATGTGTACGATTACATGTTTCATCTCTTAATCCAATACTCTAAACTCCTCCGGTTTAAACCCGAGATCCCTCAGAACTCCACTGAGCTCTGCTCAGAGGCAATGGCATGCCCGAGGGATGGAAAT---------------GAACGAAAGTTTATGATGGAATCACTCGTAAAACGCCCAGCTGAGACAGGTCCCTGCGCCATGCCGCCTCCGTATGATCCGGCATCATTTTATTCAGTTTTGAAAAGGAGACAGAGTACGACTAGTAGAATCGAACAGTGGGAGAGTAAGTACTGGAGG
Q9M2D7_ARATH/92-492 TCAAAATCATCCACGTGTCCTTCTTATTTCCGTTGGATCCATGAAGATCTACGGCCATGGAAACAAACGGGGATAACTAGAGGGATGATCGAAGAAGCGAGTAGAACGGCGCATTTTAGATTGGTGATCCGTAACGGGAAGGCGTACGTTAAGAGATATAAGAAGTCAATACAAACAAGAGATGAATTTACTCTGTGGGGAATCTTACAGTTGTTACGGTGGTACCCTGGTAAATTACCTGATCTCGAGCTAATGTTCGACGCTGATGATCGTCCCGTCGTCCGATCAGTTGACTTTATTGGTCAACAGAAG---------------GAACCACCTCCAGTTTTCCGTTACTGTTCAGATGACGCAAGCTTGGACATTGTCTTCCCTGATTGGTCCTTTTGGGGCTGGGCTGAAGTGAACGTAAAACCATGGGGGAAATCGTTGGAGGCAATAAAAGAAGGGAACAGTATGACGCAATGGAAGGACCGCGTGGCGTACGCTTATTGGAGAGGTAATCCTTATGTTGATCCT---GGAAGAGGAGATCTTCTCAAGTGTAATGCTACAGAACATGAAGAGTGGAATACTCGTCTCTATATTCAGGATTGGGATAAAGAAACAAAAGAAGGATTCAAGAACTCAAATCTAGAGAACCAGTGCACTCAT---------------------------------------------------------------------------------AGATACAAGATATATATAGAAGGATGGGCATGGTCGGTTAGCGAGAAATACATAATGGCATGTGACTCAATGACATTATATGTAAAACCAAGATTCTACGATTTCTACATACGAGGAATGATGCCATTACAACATTATTGGCCAATCAGAGACGATTCCAAGTGTACTTCTCTCAAATTCGCCGTACATTGGGGCAATACACACGAGGACAAGGCTCGTGAGATAGGAGAGGTAGGAAGTAGATTTATAAGAGAGGAGGTGAATATGCAGTATGTGTATGACTATATGTTTCATTTACTCAAAGAGTATGCAACACTCTTGAAATTTAAGCCGGAGATTCCGTTAGATGCAGAGGAGATCACGCCGGATAGTATGGGGTGTCCCGCGACGGAAAGG---------------TGGAGAGATTTTAAGGCGGAGTCAATGATTATATCTCCTAGTGAAGAGTCTCCTTGTGAGATGCTTCCTCCTTATGATCCTCTAGCTTTAAAAGAGGTTCTTGAGAGAAAAGCTAATTTAACTCGTCAGGTTGAGTTGTGGGAAAACCAATACTTTCAA