EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05538 alignment
(2 sequences with 1311 bp)


Q9F788_CAMJE/1-431 ATGAAACTAGTTAAAATTAGTTTAGTTGCAGCTCTTGCTGCAGGTGCTTTTTCAGCAGCTAACGCTACTCCACTTGAAGAAGCGATCAAAGATATCGATGTATCTGGAGTATTAAGATACAGATATGAAAGTAGCAATCCATGGAGCAATGCAAATTTTGGTTCTGGTATTTCTGGA---AAACAAGATCATAAATACAGAGCACAAGTTAACTTCAGCGGTGCTATATCAGACAACTTTAAAGCTTTCGTTCAATTTGACTACAACTCACAAGATGGTGGTTATGGCACAGATAGCATCAGTAACACAAGCGATACTTTAACAGTTCGTCAATTATATTTAACTTATACAAATGAAGATGTTGCTACAAGCGTAATCGCTGGTAAACAACAACTAAACACTATCTGGACTGACAATGGTATCGATGGTTTAGTTGGAACAGGTGTTAAAGTAGTAAACAACAGCATCGATGGTTTAACTCTAGCTGCTTTTGCAATGGATAGTTTCAATGAAGCTTCAGATACTACTGTAACAATTACTCAAGATAATAATCAAAAAATTACAGGAGTTCAATTTAATCGTGGAAATCCTAAAGGTGATAGTGATGTAAGTGGTGCTTTAGATTGGAGCAAAAATATTTATGGTGCTGCAGCTATCGGCTCTTATGATATCGCTGGTGGACAATTCAACCCACAATTATGGTTAGCTTATATGAGTGATAATGCATTCTTATATGCTTTAGATGCAGCTTATAGCACAACTATCTTTGATGGAATTAACTGGACTATCGAAGGTGCTTACCTAGGAAATTCTGTAGATAATAAACTTAAAGATAGATTAGATGCAGCAAATGGTAATTTCTTTGCTTTAAGAGGCACTGTTGAGGTAAATGGTTGGGATGCAAGTCTTGGTGGTTTATACTATGGTAAAAAAGATAAAGTTACTTTAACCACAATTGAAGATCAAGGTAATCTTGGCTCTTTGCTTGCAGGTGAAGAAATTTTCTATACTAATGGTTCTAATTTAAATGGCGATATTGGTAGAAATATCTTTGGTTATGTAACTGCTGGATATACTTTTAATGAAACAGTTCGCGTTGGTGCTGACTTTGTATACGGTGGAACAAAAACAAATATAATTGGTCAA------GGTGGTAAAAAACTTGAAGCTGTTGCAAGAGTAGATTACAAATACTCTCCAAAACTTAACTTCTCAGCATTCTACTCTTATGTAAATGTTGAT---------ACAGATCCTGAAAGCACTCATCATGATGCTGTAAGACTTCAAGCTCTTTACAAATTC
Q9ZAN1_CAMJE/1-424 ATGAAACTAGTTAAACTTAGTTTAGTTGCAGCTCTTGCTGCAGGTGCTTTTTCAGCAGCTAACGCTACTCCACTTGAAGAAGCTATCAAAGATGTTGATGTATCAGGTGTATTAAGATACAGATACGATACAGGTAATTTTGATAAAAATTTCGTTAACAACTCAAATTTAAACAACAACAAACAAGATCACAAATATAGAGCACAAGTTAACTTCAGTGCTGCTATAGCTGATAACTTCAAAGCTTTCATTCAGTTTGACTACAACGCTGTTGATGGTGGCACTGGTGTTGATAACGTAACAAATGCCGAAAAAGGACTTTTTGTTCGTCAATTATACTTAACTTATACAAATGAAGATGTTGCTACAAGTGTAATCGCTGGTAAACAACAATTAAACCTTATCTGGACGGATAACGCTATTGATGGTTTAGTAGGAACAGGTATCAAAGTAGTAAACAACAGCATCGATGGTTTAACTCTAGCTGCTTTTGCTGTAGATAGCTTTATGGCGGAAGAGCAAGGTGCAGATTTATTAGGACAAAGTACTATATCTACAACACAG------------------------------------AAAGCAGCTCCTTTTAAAGTGGATTCAGTAGGAAATCTTTATGGTGCTGCTGCTGTAGGTTCTTATGATCTTGCTGGCGGACAATTTAATCCACAATTATGGTTAGCTTACTGGGATCAAGTAGCATTCTTCTATGCTGTAGATGCAGCTTATAGTACAACTATCTTTGATGGAATCAACTGGACACTTGAAGGTGCTTACTTAGGAAATAGCCTTGATAGCGAACTTGATGATAAAACACAC---GCTAATGGCAATTTATTTGCTTTAAAAGGTAGCATTGAAGTAAATGGTTGGGATGCTAGCCTTGGTGGTTTATACTACGGTGATAAAGAAAAAGCTTCTACAGTCGTAATCGAAGATCAAGGTAATCTTGGTTCTTTACTTGCAGGTGAGGAAATTTTCTATACTACTGGTTCAAGACTAAATGGTGATACTGGTAGAAATATCTTCGGTTATGTAACTGGTGGATATACTTTCAACGAAACAGTTCGCGTTGGTGCTGACTTCGTATATGGTGGAACAAAAACAGAAGATACTGCTCATGTAGGTGGTGGTAAAAAACTTGAAGCTGTTGCAAGAGTAGATTACAAATACTCTCCAAAACTTAACTTCTCAGCATTCTATTCTTATGTGAACCTAGATCAAGGTGTAAACACTAATGAAAGTGCTGATCATAGCACTGTAAGACTTCAAGCTCTTTACAAATTC