EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05521 alignment
(4 sequences with 339 bp)


O64277_9CAUD/3-113 AAAGTTAAATATTTACCCTCTGATTTTCCATATAAAGCTGATTTTGGCACATATCAAAGTACACCCAATAAATTCACTGGCGTGAGCGTACCAAAATTT------GTTAAACAGTTTACATTGCATTACCAACCACACATACGCACACTCAATCAAGAGTACCTAGCTCAACAGAATGGCGAAGATGATACAAGGGTGATTGTTATTCGTCATAACTCAAAAGTGATTGAAGGTCAAGTTGTCGTTTTACATGGAACTCAATATGATATTATTCGTGCTAGCTCAAACGAAAACTTTGGGATTAATCGCTACGACTTCCTACCTGTGAGACAGAGAAAG
O64288_9CAUD/3-113 AGAGGTAGATATTTACCATCAGACTTTCGTTATAAAGCAGATTTTGGTACATATCAAAGCACACCCAACAAATTCACTGGAGTGAGTGTTCCAAAATTT------GTTAAACAATTTACGCTGCATTATAAACCACACACCCGAACGCTCAATCAAGAGTATTTAGCTATTCAAAATGGTGAAAATGATACACGAGTGATTGTTATTCGCCACAATGCAAAAGTATTAGAAGGTCAAGTTGTCACTTTAAACGGAACTCAATATGACATCGTGCGTATCAGTCCAGACGATAACTTTGGTTTTAACCACTACGACTTTCTAACTTTGAAAAAGCGTAAG
Q9AZS5_9CAUD/2-113 GTCAAAACTTACAAACCGAATGATTTTAACAGAAAATGTAAGATTGGAGTTACTAAAACAGTAACGGTTCCA---AGTGGAGGCAAGATTGAAAAAATTGACCCAGCAACGGTTTTAAATGTTCGATTTGCGGCTAAAATGAGATCACTTGCGCTTCAATTTCAGATAATTGGTACAACTACGGCTGATACATTCGACATTGCAATTAGACATAATAAGCTAGTTACAAAGAAAATGTTTGTTCAAATAGATGATGTTCTTTACAATATTATTAATATTTCTTCGGATGAATCTGCAAAGCTTATTAAATTTGATATTTTGACTCTTCAAGCGAAGAAG
Q9AZM0_9CAUD/1-111 ATGGCACAACTTAATCTAGCTGACTTTAACAAAAAAGTTCAACTAGGAGATGTTAAAACTTTAACTAATGAATATACAGGAGCTGGTTATGACAGTTTT------GTTCCGAAAATAAATGTTTGGTTTGCATCTAAAACAAGAACGTTGAGTCAATCATACCAACTCCAAGGAACTGCTCTTGAAAACTCACGTACGATTATCATACGACACAATTCATCAGCAGAAAAATTAAAGGCTGCTGTGATTGATAATGTCCAATATGATATCGTCAATTATTCGCCTGATGAAACAAGTAATATCATCAGGTATGATTATTTGACGCTCAAAAGGAGTTCA