EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05511 alignment
(4 sequences with 291 bp)


ATP5J_BOVIN/12-105 GCTGTTCAGTCTGCAATCTCAGTCTCTTGGAGGAGGAACATTGGTATTACAGCAGTGGCATTTAATAAGGAGCTTGATCCTGTGCAGAAACTCTTCGTGGACAAGATTAGAGAATATAGAACTAAGCGACAGACATCTGGAGGACCTGTTGATGCTGGCCCAGAATATCAGCAAGACCTAGACCGGGAGCTTTTTAAACTTAAGCAAATGTATGGTAAA---------GCAGACATGAATACGTTCCCTAACTTCACGTTTGAAGACCCCAAGTTCGAAGTTGTCGAGAAA
ATP5J_MOUSE/12-105 GTCCTTCGGTCAGCAGTCTCTGTGCATTTGAAGAGGAACATTGGTGTTACAGCTGTGGCCTTTAATAAGGAACTTGATCCTGTACAGAAACTCTTCGTGGACAAGATAAGAGAGTACAAATCAAAGCGACAGGCATCTGGAGGACCTGTTGATATTGGCCCAGAGTATCAGCAAGATCTGGACAGAGAGCTTTATAAGCTTAAACAAATGTATGGTAAA---------GGAGAGATGGATACATTTCCTACCTTCAAATTTGATGATCCCAAATTTGAAGTCATCGACAAA
ATP5J_DROME/12-103 GTCCTGCGCACA------------GAGGCCCGTCGTAACTTCGGAATCGTTGCCCCTGCCCTGAACAAGGCCTCCGATCCCATCCAGCAGCTGTTTCTGGACAAAGTGCGCGAGTACAAGCAGAAG---AGCGCCGGTGGCAAGCTGGTGGACTCCAATCCCGATATTGAGCGGGAGCTGAAGACCGAACTGGACCGTGTGGCCAAGCAGTTTGGCAGCGATGGCAAGACCGACATGCTGAAGTTCCCCGAATTCCAGTTCCCCGATGTTAAGGTCGATCCCATCACCCAG
Q9VZ72_DROME/1-96 ATGTTTAGCCGTTTCCTAAAACCAAGCCTAGTTTTATGTAGGAGTGTGAGCAATACCGCATCCCTTCGCTACAAGGATCCCATTTATCAGATTTTCCTGGACAAGGTGCGCGAGTATCGGCTGAAG---AGTCCCAAGGGAAAGCCCGTAGATCCTGGTCCGGAATTCGAGGCGGAGCTGAAGGAAGTCACTGAGCGCCTGGCTCTGCAATACGGCGGCGGCGAGGGCGTGGATATGCTCGAGTTTCCGAAATTCAAGTTGCCCGATATTGATATTGATCCCATTTCGGTT