EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05413 alignment
(2 sequences with 276 bp)


Q9IMS9_9VIRU/844-935 AAGAGAAAATTTATAGAAGGTAAATATGATTGCCTCTTTGTTGCAATGGCCGCAATGATTTCAAAAAAACCAGAGGACATAATGTTTAAATGTCTTAACACTCTTGACAGATGTGTGATGAATAAGGGATGTGATCTCACTGACCTGAGGTCCATATGCAGTGGATATGAGATCAAAGTTGAATGTCAGGGTGATTGTGGTTTGGTGGAGATTGGGGATATTGGACTTCCCCTTGGCAAGTTGATTTTGAGGGGGAATCATTTCACCTTGTGTTCA
RRPO_ACLSP/843-934 AAGCTTAGATTCATCAAGGGTAAATTCGACTGCCTATTTGTCAGTGTGGCTGAAATAATACACAAAAAACCAGAGGAAATCATGATGTTCATCCCACACATTATGGACAGGTGTGTGAGTAATAGGGGTTGCTCACTTGATGATGCAAAAGCAATATGTGAAAAATATGAAATCAAAATAGAGTGCGAAGGCGATTGCGGCTTGGTTGAGTGTGGGACATCAGGTCTTTCCATTGGAAGGATGCTGCTTAGGGGAAACCACTTTTCTGTCGCTTCA