EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05407 alignment
(5 sequences with 498 bp)


POLN_RUBVM/1109-1274 TGGCGCTGCCGCGGCTGGCAGGGCATGCCGCAGGTGCGGTGCACCCCCTCCAACGCTCACGCCGCCCTGTGCCGCACAGGCGTGCCCCCTCGGGTGAGCACGCGAGGCGGCGAGCTAGACCCAAACACCTGCTGGCTCCGCGCCGCCGCCAACGTTGCGCAGGCTGCGCGCGCCTGCGGCGCCTACACGAGTGCCGGGTGCCCTAAGTGCGCCTACGGCCGCGCCCTGAGCGAAGCCCGCACTCATGAGGACTTCGCCGCGCTGAGCCAGTGGTGGAGCGCGAGCCACGCCGATGCCTCCCCTGACGGCACCGGAGACCCCCTCGACCCCCTGATGGAGACCGTGGGATGCGCCTGTTCGCGCGTATGGGTCGGCTCCGAGCACGAGGCCCCGCCCGACCACCTCCTGGTGTCCCTCCACCGTGCCCCCAATGGTCCGTGGGGCGTAGTGCTCGAGGTGCGCGCGCGCCCCGAGGGGGGCAACCCCACCGGCCACTTC
Q99IE7_RUBV/1109-1274 TGGCGCTGCCGCGGCTGGCAAGGCATGCCGCAGGTGCGGTGCACCCCCTCCAACGCTCACGCCGCCCTGTGCCGCACAGGCGTGCCCCCTCGGGTGAGCACGCGAGGCGGCGAGCTAGACCCAAACACCTGCTGGCTCCGCGCCGCCGCCAGCGTTGCGCAGGCTGCGCGCGCCTGCGGCGCCTACACGAGTGCCGGGTGCCCCAAGTGCGCCTACGGCCGCGCCCTGAGCGAAGCCCGCACTCATGAGGACTTCGCCGCGCTGAGCCAGCGGTGGAGCGCGAGCCACGCCGATGCCTCCCCTGACGGCACCGGAGATCCCCTCGACCCCCTGATGGAGACCGTGGGATGCGCCTGTTCGCGCGTGTGGGTCGGCTCCGAGCACGAGGCCCCGCCCGACCACCTCCTGGTGTCCCTCCACCGTGCCCCCAATGGTCCGTGGGGCGTAGTGCTCGAGGTGCGTGCGCGCCCCGAGGGGGGCAACCCCACCGGCCACTTC
Q99IE5_RUBV/1109-1274 TGGCGCTGCCGCGGCTGGCAAGGCATGCCGCAGGTGCGGTGCACCCCCTCCAACGCTCACGCCGCCCTGTGCCGCACAGGCGTGCCCCCTCGGGTGAGCACGCGAGGCGGCGAGCTAGACCCAAACACCTGCTGGTTCCGCGCCGCCGCCAACGTTGCGCAGGCTGCGCGCGCCTGCGGCGCCTACACGAGTGCCGGGTGCCCCAAGTGCGCCTACGGCCGCGCCCTGAGCGAAGCCCGCACTCATGAGGACTTTGCCGCGCTGAGCCAGCGGTGGAGCGCGAGCCACGCCGATGCCTCCCCTGACGGCACCGGAGATCCCCTCGACCCCCTGATGGAGACCGTGGGATGCGCCTGTTCGCGCGTGTGGGTCGGCTCCGAGCACGAGGCCCCGCCCGACCACCTCCTGGTGTCCCTCCACCGTGCCCCCAATGGTCCGTGGGGCGTAGTGCTCGAGGTGCGTGCGCGCCCCGAGGGGGGCAACCCCACCGGCCACTTC
Q9J6K9_RUBV/1122-1287 TGGCGCTGCCGCGGCTGGCAGGGCATGCCGCAGGTGCGGTGCACCCCCTCCAACGCTCACGCCGCCCTGTGCCGCACAGGCGTGCCCCCTCGGGTGAGCACGCGAGGCGGCGAGCTAGACCCAAACACCTGCTGGCTCCGCGCCGCCGCCAACGTTGCGCAGGTTGCGCGCGCCTGCGGCGCCTACACGAGTGCCGGGTGCCCCAAGTGCGCCTACGGCCGCGCCCTGAGCGAAGCCCGCACTCATGAGGACTTCGCCGCGCTGAGCCAGCGGTGGAGCGCGAGCCACGCCGATGCCTCCCCTGACGGCACCGGAGACCCCCTCGACCCCCTGATGGAGACCGTGGGATGCGCCTGTTCGCGCGTATGGGTCGGCTCCGAGCAAGAGGCCCCGCCCGACCACCTCCTGGTGTCCCTCCACCGTGCCCCCAATGGTCCGTGGGGCGTAGTGCTCGAGGTGCGTGCGCGCCCCGAGGGGGGCAACCCCACCGGCCACTTC
O40955_RUBV/1109-1274 TGGCGCTGCCGCGGCTGGCAGGGCGTGCCGCAGGTGCGGTGCACCCCCTCCAACGCTCACGCCGCCCTGTGCCGCACAGGCGTGCCCCCTCGGGTGAGCACGCGAGGCGGCGAGCTAGACCCAAACACCTGCTGGCTCCGCGCCGCCGCCAACGTTGCGCAGGCTGCGCGCGCCTGCGGCGCCTACACGAGTGCCGGGTGCCCCAGGTGCGCCTACGGCCGCGCCCTGAGCGAAGCCCGCACTCATAAGGACTTCGCCGCGCTGAGCCAGCGGTGGAGCGCGAGCCACGCCGATGCCTCCTCTGACGGCACCGGAGATCCCCTCGACCCCCTGATGGAGACCGTGGGATGCGCCTGTTCGCGCGTGTGGGTCGGCTCCGAGCACGAGGCCCCGCCCGACCACCTCCTGGTGTCCCTCCACCGTGCCCCAAATGGTCCGTGGGGCGTAGTGCTCGAGGTGCGTGCGCGCCCCGAGGGGGGCAACCCCACCGGCCACTTC