EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05386 alignment
(7 sequences with 90 bp)


TEP1_HUMAN/31-60 TTGGAGAAACTACATCAGCATGTATCTACCCACTCAGATATCCTCTCCTTGAAGAACCAGTGCCTAGCCACGCTTCCTGACCTGAAGACC
TEP1_HUMAN/91-120 ATGGAGAAACCACATGGACATGTTTCTGCCCACCCAGACATCCTCTCCTTGGAGAACCGGTGCCTGGCCACCCTCCCTAGTCTAAAGAGC
TEP1_RAT/91-120 CTGGAGAAGCTATGTGGACATATGTCTAGTCACCCAGACGTCCTCTCTTTGGAGAACCGATGTCTTGCTACCCTCCCGACTGTAAAGAGA
TEP1_RAT/1-30 ATGGAGAAACTCTGTGGTTATGTGCCTGTCCACCCAGACATCCTCTCCTTGAAGAATCGGTGCCTGACCATGCTCTCTGACATCCAACCC
TEP1_MOUSE/61-90 ACGGAGAGAATAGATGGGCATATATCTGTCCACCCAGACATCCTCTCCTTGGAGAATCGGTGCCTGACCATGCTCCCTGACCTCCAGCCT
TEP1_MOUSE/31-60 CTGGAGAAAATACATGGACATAGATCTGTCCACTCAGACATCCTTTCCTTGGAGAACCAGTGTCTGACCATGCTCTCTGACCTCCAGCCC
TEP1_RAT/31-60 CTGGAGAAAATACATGGACAGAGATCTGTCAACCCAGACATCCTGTCCTTGGAGAACCGGTGCCTGACCTTGCTCCCTGATCTCCAGCCC