EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05382 alignment
(2 sequences with 513 bp)


O34082_9CAUD/1-171 ATGAGCGTAAAACAAAAACTAGTAGATGGAATGGTTAACCTTAGAGGAAAAATCACTTACTCGATGTTTGGTTCTCGTGATGGTTCTGATGGAACTGGTGACTGTTCGGGTATTATGTCTAGAGTCTTGAAAGAGGCAGGAATTAATATCCAAGGGTTGCCATCGACTGTAACTCTTGGACAACAACTAGCAAATAATGGCTTCTATCGTATAAGTCGTAACGAAGACTGGAATGCTGAAACTGGTGATGTTGTGTTGATGTCTTGGGGTACTGATATGTCTAGCTCAGGTGGAGCTGGTGGCCATGTCGGTGTTATGATGGATGCTACATACTTTATCAGTTGCGACTATTCAACTCAAGGAGCAGTAGGACAAGCTATCAATACGTATCCGTGGAATGATTACTATGCAGCTAATAAGCCTGCATATATCGAAGTTTGGCGCTATGCTGACTCTGCCCCACAGACTAATAACAAAGCTAATACAGCAGTAGTAACAAAAGAGAAGGCATAT
O21982_9CAUD/8-178 ATGAATGTCCCACAATCTCTTGTTAATTGGTTTGTCAATCATCGCAATCTGCTTACCTACTCGATGTATGGCTCACGTAATGGATCAGACGGAACAGCCGACTGCTCTGGTTCTATGTCACAAGCCTTAAAAGAGGCAGGCATTCCTATCCAAGGGCTACCATCTACTGTCACACTTGGTCAACAACTTGCTAAAAATGGCTTCTATCGTATAAGTCGTAATGAAGACTGGAATGCTGAAACTGGTGATATCGTATTGATGTCGTGGGGCGCAGACATGGCTAGCTCTGGGGGAGCTGGTGGACACGTTGGTGTAATGATGGATAGCGTAAACTTTATTTCTTGTGACTACTCAACTCAAGGAGCAGCAGGGCAAGCTATCAATACGTATCCGTGGAATGATTACTATGAAGCTAATAAGCCTGCATATATCGAGGTTTGGCGCTATTCTGAATCAGCACCACAAACCAAAAACCAAGCGAATACAGCAGTAACTCCACAACAAAAGGCTTAC