EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05145 alignment
(8 sequences with 1020 bp)


Q9KLW2_VIBCH/33-345 GAAATGTTTATTGCCTCGGGTTTGGTTATTGTGCTGCACAAGAAGCGTTGGCTAACTATTCATACGCCGCCGTGGCTGCTG---------------------CTGTTTGTGCAAGTCGTGCTTGGGATCAGTGTCGGCGCGACCATCAGTTTGAGTGAGCTAGGCACCACCTTAACCTTGCCGGTGATCGTGGGTTTGGTGTGCTGTTTAACGCTGCAAATTATCAGTAGCTATTTGTGGCTCACCAAAAAAGAGGGCTGGACGCCG---TTTGAATCTCTACTCGGTGCCGTACCGGGTGCCATGGCCGCGATTTTGGTGATCAGC---GAATCAAGCGAAAAGCCTTCCGCCAAAGTGGTCTATTCCCATTCTGTGCGCCTGATGATCCTCACTTTGTTGGCACTGTTGATCTCCAACAGCGCGCCAGATAGC---------------------GCATCCGTAGACGGCAGCCTGACCGTTTAC---------------GCTTGGCTTATTTTCTTGGCTCTGGCGCTGATGAGTTTGCTACTGGGTAAAGCTTCCACCTTACTCGGCATTCCTGCGCCTTATATGTTAGCGGCGTTACTCATCACCGCCAGCTTTAATGGCTTTGCC---------------ACCGGCATTGATATGCAACTGCCGAAATGGATGGTGATATTCGCCACCGCTTTACTCGGCATTTTGATCGGCTCACGCATTGCCGATACCACACTGCGCGAACGCATGGCGTATTCCCGCGCAGGGGTAATGGTCACCATGATTGGCCTTTTGGTCGCGGTGGGTGTCTCCGGCGTCTTTTCTATTTTGATCGATAAATCATGGGTCGTGCTGCTGCTTTCTTGGGTTCCCGGCAGTGTAGAAGCCATGACCGCCGTCGCCTTGTTACTCGGC---ATGGAACCGGCGTTTGTGATGATTAACCACGCTCTGCGCCTGTTGTTGCTCTACTCACTGCCCGCCATGCTGAAAAAGCAGTTGGAGGAGTTGAGGGGG
Q99TJ6_STAAM/31-352 TTTATGTTTGGTCCTATTATCGCATCAATCATTTGTGTGAAAGTTTTCAAACTTGATATTAAATGGCCATTCTTACTTAGT---------------------GAATTAGGGATTGTACTATTAGGGGTGCAAATCGGATCAACGTTTACGAAAAATGTCGTTATGGATATTAAAAACAATTGGCTTTCGATTATTGTTGTATCTATTTCGATATTATTAATTGCAATAGTAATGGCATTTATTTTTAAAAAAATTGCACGTATTAATACAGAAACAGCTATTTTAAGTGTTATACCAGGAGCACTAACACAAATGCTGGTCATGGCTGAACAAGACAAACGTGCTAATTTGTTAGTTGTTAGCTTAACGCAAACATCACGAATTATATTTGTTGTTGTTTTAGTACCGTTCATTTCATATTTTTTTCATGATGGT------------AACATGCATGCGAATGGAAAGTTAACAAAAGTCTTGCCTTTATCACAAGTATTAAACATAGGGCAAATAGTTATTTTAGCGATAGCTATCTTTATAGTTTATCTAATTATGTCTAAAATAAAGTTTCCAACATTTCAATTATTAGCACCACTCATTGTATTAATTGTTTGGAATTTTTCT------------------ACAGGTTTAACATTTACACTAGATCATTGGTTGTTGAACATGGCACAACTAATATATATGATTAGAATTGGAGTTCAAATTGCGCATTTATTGTCAGATTTAAAAGGTAGACTAGCAATCGCAATTACAATTCAAAATATTATGTTGATAATTGGTGCGCTAATCATGGTTTATATCATACATTTCTTTGATAATAATCCTATTAATGAATTGTTTCTTGGTGCAGCACCAGGAGGGGTTAATCAGATAGTTTTAGTTGCATTAGCTACTGGT---GCCGATGTTGCTATGATTACGAGTTATCATATTTTCCGAATCTTTTTCATCCTATTTATTATTGCACCAGGAATTAATTACTTTTTAAAATATCGTTCG
Q9RC51_BACHD/27-340 TGGCTATTAGGCTCACTTTTGTCAGGAATGGTCTGTACATTATGGATAAAGAAAATCATGCTACCTGATCGATTGTTTAAA---------------------TGGACA---TTGGCTGCGATTGGTGGCAACATCGGCTTCATGTTAAGGCCTGAGCAATTTTTGCAATACCACTCCTTGCTCGGTCCTTTTGTCGTTACTCTTGTTTTGACATTATGCGGCGGGATTTTACTCGGGAAGTTTTTAAAACGGTTCTCAAACGTGAATCACAATACGGCGTTCTTTTGCTGCATGCCAGGAGGAGCCTCGGAGGTTATTGCGCTCAGT---AAAGACTATGGGGCTGATCAACGGATTGTAGCCGCTTTTCATACGACAAGGATTACATTTTTTGTTTTTGTCATCCCTCTATTTGTTGGCTTAAATGTGACGGGG---------------------CGGACGGGACTGGGTACAATGTTTCTCCCACTAGAT------GAGACGCTTTTAGCGCTTGGGGCATTAATGGCAGTCGTTGTGTTGACCATTTTTCTGAGCAAGCATGTGACGTTCCCAGGAGCATCCCTCTTCTTTGCGATCGGTCTTGGCTTTCTTGTCCACACACTG---------------------TTTCCTCAGATCATTCTTCCGGGCTATGTGCAAGGTGTGGCTCAAGGAGTGATGGGAGCGGTAATCGGTGCTCGATTTGATCGAGAAACCTTTGGTGAATTGAAGCGAATGGGGTTTATTAGCGCCATTACGTTGTTGCTATATTTCATTATGAGTCTTGGATTGGCAGGTTTATTTACGTGGATGACACCACTAGAATGGTACATGAGTTTACTTAGCATTGTCCCGGCTGGAGCAGCGGAAATGGCTTCAACGGCTACGGCCTTGCAA---ATGGAGCCAGCGATGGTAGCGACCTTACAGATGGCGCGAGTGCTTGCCCTTTTCCTTTGCCTACCATTTCTGATTAAGTGGTTTTCAAAGCAAGATAAC
Q9I5H8_PSEAE/33-345 TGGATGATCGGCTCGCTGCTTGCGGTGATGCTGGTGCGTTGCCTGGCCGACCTGCCGCTGGCCGAAGTGCCGGGGGCACGC---------------------AAGTGCGGGCAATGGATCGTCGGCATCGGCATCGGCCTGCACTTCACCCCGGCAGTGATCGAGCAAGTGCTGGCGCATAGCGTGATCATCGTCTTCGGCGCCGTGGCCACCACGCTTTCCAGCGTGCTGGCGATCGCCTTCATGCGCCGCAGCGGCGAGGACCGC---GCCACCGCGTTCTTCGCCAGCATGCCCGGTGGTGCCAGCGAGATGGTCAACCTCGGG---CAGCGCCACGGCGCGGTGCTCAGCCGCGTCGCCGCAGCGCAGAGCCTGCGCCTGTTGCTGGTAGTGCTGCTGGTGCCGGCGGCGTTCCAGTACCTGCTCGGC------------------------GGCGGCCAGCCAGGCCCGCACCAGGCCGCGCCG---------GTGGACTGGCACTGGCTGGCCCTGCTGTTCCCGGCCGGGGCGCTGGTCGCGCTGGGCTGGCAGAAGTTGCGCCAACCCAATCCCTGGCTGCTCGGCCCGCTGTTGCTGGCGGCCGGCGTCAGCCTCGGC------------------TTCGACCTGCATATCGGCCTGCCGGCCGGTTCCAGCGGCGTCGGCCAATGGCTGATCGGCAGCGCCCTGGGTTGCCATTTCAACCGCAGTTTCTTCCGCAGCGCTCCAGCCTTCGTCAGTCGTACCCTGGTCTGCACGCTGTGGATGATGTTCGCCGCGGCGCTCGCCGCCGAGTTGCTCGGCTGGCTGACCACCCTCGACCACCAGTCGCTGATGCTCGGCATGATGCCCGGCGGCATCGCCGAGCTGAGCCTGACCGCCGAAGCCTTGCAG---CTCTCGGTGCCGCTGGTCACCGCCTTGCAGGTACTGAGGCTATTGCTGGTGCTGTTCCTCGCCGAGCCGTGCTTCCGCTACTGGAGGAAGCGCGCCGGC
O69766_PSEPU/200-509 TGGATGGTCGGCTCGTTGCTGGCGATCATCCTGGTACGCTGCGTGACGCCATGGCAACTGACGAAATCCCGGCGGGCG------------------------AAGTGCGGCCAGTGGATCGTCGGCATCGGTATCGGCCTGCACTTCACCCCGGTGGTGATGGAGCAGGTGCTGAGTCATTTCGGTTTGATCTTTTTCGGTGCCCTGGTCACCAGCCTGTCCGCTGTGGTCGGCGTCTGGCTGATGCGCCGCACCGGCGAAGATCGC---GCCACGGCGTTTTTTTCAAGCATGCCCGGCGGTTCCGGGGAGATGGTCAACCTGCAC---ACACGCAACAGCAGCTGCTCAGCCACCTCGCGGCCGGGCAAAGCCTGCGGGTGCTGGTGGTGGTGCTCTGCGTGCCCGGCGGCCTTCAAGTACCTGCTCGGC------------------------GATGGCAACCCGATTGCCCATGCCGGCAGC------------ATCGACTGGCGCTGGCTGGCACTGCTGTTTCCGGCGGGCGCCCTGCTCGCCTGGGTCTGGGAACGCCTGCGCCACGCCAATCCCTGGTTGTTCGGGCCGTTGCTGGTGAGTGCGGCGGTGAGTATCGGG------------------TTTGACCTGCACATCGGCCTGCCCAAC---GCGGCAGCCAGATCGCAGTGGCTGATCGCAGCGGCCTGGGCTGTCACTTCAACCGCCAGTTTTTCCGCCGCGCAGCCGTCGTTCATGGGCCGTACCTTGATCGGCACCGTGCTGACCATGTTGATCGCGACGTTGGCAGCCCTGGGTTTGAGTGCGCTGACCCATCTGGACCTGCGTTCGCTGACCCTGGGCATGATGCCCGGCAGGATTGCCGAGATGAGCCTGACGGCCGAGACCCTGCAA---CTGTCGGTGCCGCTGGTGACGGCGATGCAGGTGATGCGGTTGCTGTTTGTGTTGTTTCTGGCGGAGCCGTTGTTCAAGTACTGGAACCGTGATCCGGAG
O07568_BACSU/33-370 TGGATGATCGGAACACTGATTGTCGCCTGCTGCCTCGCCATGATACGGCCGGCATGGCTGATGATGGCACCAGACCAAAAAGGAATTAACCGACGATGGCTCGCCCTCGGGCAGATGATCCTCGGCATCGAATTGGGCCAAAAGCTGAATTTATCCGTTCTCTCTGTTCTCAAAGACCATTGGTTTTCAGTCGGCGTTATGCTGATATTGTCTATCCTGCTGGCCATGCTGTCAGGATATGTGCTTTGGCGTTTCAGCAAAACGGATATGATGACTAGCTTTGTCGGCACCGCTCCCGGCGGACTTTCCGCCATGCCGAGCATCGCA---CAGGAAGTAGGCGCCAATACCGCTATAGTCAGCCTCGTTCAAATGATGCGTGTGCTGCTCGTGGTGCTTTCCATTCCGTTTTTAGTCATTCTGATCTATACAAAACAAGATCGTACCGCAAGTGCCGCAGCAGAGACGATTTCTTCTGCAACGACAGATTTTAGGCTCGCTCCCGTTTTGTGGACCGTCATTCTTATTCTCGCTGCCTGGGGAGCTTGCAAAGCTGCGAAATTTTTAAAATTTCCAGCTCCATGGCTGCTCGGCAGCATGCTCGGTGTAGCAATTGTACATGTTGGCGGAGCTGCGGTGACAGGGCACGACATGACGGCATGGTGGTTGTCACAAGCTAACCATGTATCACAAGTATTTCTCGGGGCAACGATCGGCTCTAAGATGTACAAAAGCATGTTTGCCGGCGTCACCCGTATTATCATCGTCGGGTTTGTCTCGTCCGTCGGTTTAATCGCAGCAATGTTTTTGAGCGCCGTGATCGTTTCCGAGCTGACAGGAATTTCGCTCATCACTTCTGTTCTGGCATTTGCGCCCGGCGGGATTGCAGAGATGGCGACGACGTCAGTTACCTTACAT---GCTGATTCCACCTTTGTCGTTGCGGTTCAGGTCATTCGCGTCATTCTGGTTATTGCCCTGCTGCCGCCGTTTTATCGCCTGCTTCACCATCTTCATGGT
Q98HN9_RHILO/33-349 CTGCTGATCGGACCGATGCTGGCGGCGATTGTCGCCGGCACCAATGGC---GCGACGGTGCGGGTGCCTCGCCTGCTGTTC---------------------GGCTCCGCCCAGGCCATTGTCGGCTGCCTCGTCGCCGCGTCGATCTCGGCCGACATCTTTCCCGTGTTCTACCAGGAATGGCCGCTGTTCCTCGGTGTGGTGATCGCCACCGTCGCGGCCTCCAGCCTGCTTGGCTGGCTGATCAGCCGCTGGCGCATCCTGCCCGGCACCACCGCCGTCTGGGGCTCCTCGCCTGGCGCCGCCACCGCCATGGTGCTGATGGCC---GGCGCTTTTGGCGCCGACCAGCGCCTCGTCGCCTTCATGCAATATCTGCGGGTCATCTTCGTTTCGATGACGGCGGCGATTGTCGCCAAGATGTGGGTCGACACG------------TCGGGCATCGAAGTCCCACCC---ATCATCTGGTTTCCGCCG---------ATCGATGTCCAAGCCTTCGCCGCCACGTCAGGCATCGCGCTGGTCGGCGGCCTTGCGGGGAAGCTGTGCCGGCTGCCCTCGCCCTTCTTCCTCGGCACCTTCATCTTCGGCGCCATCGTCCATCTCGGC------------------CTCGGCGTCGAGATGCAGTTGCCCCCCTGGCTGCTGGCGATCAGCTACGCCATGGTAGGCTGGTCGATCGGGCTGAACTTCACAAGGCCGATCCTGCGCCATGCGACGCGCGCTCTGCCGCAGATCATCGCCTCGATCGTGGCGCTCATAGCCTTTTGCGGCGGGCTCGCCTTCCTGATCAGCCATCTCCTGGGCATCGATCCGCTGACCGCCTATCTGGCGACCAGCCCCGGCGGCATGGACAGTGTCGCCATCATCGCCGCCGCGGCGCAGCACGTCGACATCTCCTTCGTCATGGCGCTGCAATCGGCCCGCTTCCTGATCGTGCTGCTCGTCGGCCCGAGCGTCGCCCGGCTGGTGGCCAGAAGCATCAGG
ABRB_ECOLI/29-344 CTATTACTTGGGCCGATGATCGCCGGGATCATCTTTAGTATGCGCGGA---ATTACTCTGCAACTTCCCCGCTCTGCTTTT---------------------CTCGCCGCCCAGGCCATTCTTGGCTGCATGATTGCGCAAAACCTCACTGGTTCGATTCTCACCACCCTGGCCGTCAACTGGCCGATCGTGCTTGCAATTTTACTGGTAACGCTGCTTTCCAGCGCCATTGTGGGTTGGTTATTGGTGCGCTATAGCTCATTGCCTGGAAATACCGGTGCCTGGGGCTCCTCTCCTGGCGGCGCGGCGGCAATGGTCGCTATGGCG---CAAGATTACGGCGCAGATATTCGCCTGGTGGCGTTTATGCAATATCTGCGAGTGCTGTTCGTCGCGGGGGCCGCTGTTCTGGTCACCCGCATGATGCTGGGCGAT------------AACGCTGAAGCGGTTAACCAGCATATCGTCTGGTTCCCGCCA---------GTGAGCATTAAT---CTCCTGCTTACTATTTTGCTCGCGGTCGTTGCCGGTACAGTGGGATGCCTGCTGCGTCTTCCTTCCGGCACGATGCTCATCCCGATGCTGGCGGGCGCAGTGCTCCAGTCTGGT------------------CAGCTCATCACCATCGAACTACCGGAATGGCTGCTGGCGATGGCGTATATGGCAATTGGCTGGCGGATTGGTCTTGGTTTCGATAAACAAATCTTACTGCGGGCACTACGCCCGCTACCGCAAATCCTGCTGTCGATTTTTGCTCTGCTGGCTATTTGTGCGGGTATGGCGTGGGGGCTGACCCGGTTTATGCACATTGATTTTATGACTGCCTACCTCGCCACCAGCCCCGGCGGGCTTGATACCGTGGCGGTCATCGCCGCAGGGAGCAAT---GCCGATATGGCGCTCATTATGGCGATGCAAACCCTACGCCTGTTCAGTATTTTGCTGACAGGGCCTGCCATTGCGCGGTTTATTTCAACCTATGCGCCG