EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05096 alignment
(3 sequences with 888 bp)


Q9A125_STRPY/1-239 ATGAGT---------------------------------------------------------------------------------------------------------ATTATGATAACTAAAGGACAAGTT---------CGTTTGTTACGAACTTATTCTTATGATAGCAACTTATACACGCAGGGATTAGAACAACTCAACAACAATCATATATTACTTAGTGCCGGTCGTTATGGTTTCTCAAAAGTAGGGGTGTATGACCTTACTCAAGAGATCTTTTCAGAAAAAATAGCTTTTCCAGATACAGTT---------TTTGCAGAAGGGCTAACAGTTGTTGAGGATTATTTTTGGTTACTAACCTATAAAGAGGGTGTAGCCTACAAGTTTGATAAGGCTACCTGCAATTGTTTAGGGGCCTATCCATTTGAAGGAGATGGCTGGGGATTAGCCTATGATAAGGAAAACCAGTGTCTTTGGATGACTAGTGGAAATGCTTTTTTGCAAAAGCGAGACCCCAAAGATTTTGCTTTATTGGATACCGTACTAGTTGCTATAGAAAGTGTCCCCATCTCAATGCTTAACGAATTAGAGTATGTAGATGGTTATCTCTATGCCAATATTTGGCAAACCAATACTATTGTCAAACTCCAACCTGATTCTGGAAAGGTGGTAGCCACCTATGATATTAGCCCTTTGTTAAAAGCCTTAAATCTTGATAAGTCCCATTACCCTGAC------------CTTAATGTTTTGAATGGGATTGCTCAT---TTAGATCAACAACGTTTCTTAATTACTGGCAAACTATACCCGCTGATGTTAGAAGTAGTATTA---------------------------------GAT
Q9A519_CAUCR/1-260 GTGAAA------------CTGCTTTTGCGTCGCCTCGGCGGCTTGGTGCTGGCCGCC---------------------------------GCCATCGGTTTGGCCGCGCCCGTGCTGGCGGCCCCGGCGCCGGTGGGCGGCTACAAGGTCGTGAAGAGCTATCCGCACGACACCCGGGCGTTCACCCAGGGCCTGCTTTAT---CGCGACGGCTTCATCTTCGAGAGCACGGGCCTGCAGGGCCGGTCGTTCATCCGCAAGTGGAACCTGGAAACCGGCGCCATCGAGGCCGAGCGGACCATCGACTCCCGCTAT---------TTCGGCGAAGGCATCGTCGACTGGAAGAACCGGGTCTATGCGCTGACCTGGACCGACCAGGTCGGCTTCATCTACGACATCGACAGTTTCGAGACGCTGGGCGAGTTCAGCTATCCCGGCGAGGGCTGGGCCCTGACC------CGCGACGACAAGCGGATCATGATGAGCGACGGCACCGCCTTCATCCGCTTTCTTGATCCCGAGACGCTGAAGGAGACGGGGCGCATCCAGGTCACCGACAACGGCGTCCCGGTCACCAAGCTCAATGAGCTGGAGTGGGTGAAGGGCGAGCTTCTGGCCAATGTCTGGCAGACCACCCGCATCGCGCGGATCGACGTGGCGACCGGGCGGGTGAAGGGCTGGATCGAACTGGCCGGCCTCCTGCCGGAAGCCGGCGTGCGGGGCGACCGC---------------------GACGATGTCTTGAACGGCATCGCCTATGACGCCGCCGGCGATCGTCTGTTCGTCACGGGCAAGCTGTGGCCCAAGCTGTTCGAGATCAAGCTGACCGAA------------------------GCGAAC
Q9RY39_DEIRA/1-294 ATGCGCCGCTCCCCCGCCCTGTCGCTGTCGACCTTCGCCCTGCTGGCCCTCGCCGCGTTGCCCCTGGCCCTGTCGTCCGCCCCCACCCCGACCCGTGCTCCTGCGGCCAAGGTGAGCAGCGCCCGCACGCCGGTGCTGCGCCCGGTGGTCGCGGCGCGCTACCCGCACGACCGCGCCGCCTTTACCCAGGGCCTGCAGTACCTCGGCGGTGGGCACTACCTGGAAAGCACCGGGCAGGTGGGCGAGTCCGATCTGCGGGTCAGCGAACTGCGCGGAGCGAAGGTGCTGTGGAGCACGCCGCTCGCGCAGGCGCTGCCGCAGGCGTTCGGCGAGGGGTCCACGCAACTCGGCAGCACCGTCTACCAGCTCACCTGGCAAGACGGCGTCGCACTCACCTACGACGCCCGCACCTTCAAGGAAACGGGCCGCCACCGCTATCAGGGCGAGGGCTGGGGTCTGACG------AGCGACGGCAAGAGCCTGATTATGAGCAACGGCACCTCTACGCTGGTCTGGCGCGACCCCAAGACCTTCGCCGCGCAGCGCAGCGTGCAGGTCACCGACCAGGGGCAGCCGGTCCGTAACCTCAACGAACTGGAATACGTGCAGGGCTCGGTCTACGCCAACGTCTGGCTGACCGACCGTATCGCCCGGATTCACCCGCAGACCGGCAAGGTTCTGACCTGGATCGACGTGTCGGACCTCACCCGCGAGGTCAGCGCGGCGGCGACAAAACAGGGTCAGGCCCTCACCTTCGACGACGTGCCCAACGGCATCGCCTTCATTCCCGAGCGCGGCACACTGCTGCTGACCGGCAAGCGCTGGCCGACGCTGTTCGAAGTGAAGGTGCCGGGGTTGGGGCTGAAGGTGGAAGGCGCGAAGAAC