EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04956 alignment
(5 sequences with 240 bp)


Q9PBT4_XYLFA/44-123 CCGGCGTTCGCGTCAAACACGGCTGGCGGTGGTCTACCTTCAGATGAATGGTTCACTAGAATTCGCGAGTCTGTGACAGGTCCGTTTGCATTTACCGTAGCGATTGTTGGCATCGTTGCTGCTGGTGCAGGGCTTATTTTCGGTGGTGACATGAACGGCTTCTTGCGCACGCTCATCTTCATCGTCCTGGTGTTGTCCTTCTTGGTTGCCGCACAAAACAGCCTGAGTGCGATCACGGGG
P71178_ENTAE/33-112 CACGCATTCGCCTCCGAGGGCACCGGCGGCTCTCTGCCGTATGAGAGCTGGCTGACCAACCTCCGCAACTCCGTCACCGGCCCGGTGGCCTTCGCGCTGTCGATCATCGGCATCGTGGTCGCCGGCGGCATCCTCATCTTCGGCGGCGAACTCAACGGCTTCTTGCGCACGTTGATCTTCATCGTCCTGGTCATGGGCCTGCTGGTCGGCGCGCAGAACATGATGAGCACGTTCTTCGGC
O66170_9RHIZ/25-102 CCGGCCTTCGCCTCT------TCAGGCGGCAGTCTGCCGTGGGAATCCCCGCTTCAGCAAATCCAGCAATCGATCACCGGTCCGGTTGCCGGCTTCATCGCACTCGCCGCAGTCGCGATCGCCGGCGGCATGCTGATCTTCGGGGGCGAGTTGAATGATTTCGCAAGGCGGCTTTGCTACGTCGCCCTCGTTGGCGGCGTTCTGCTCGGCGCGACACAGATCATCGCCCTGTTCGGCGCA
Q98P50_RHILO/25-103 GTCGCTCCGGTCGCCCATGCATCGGGCTCCTCGATGCCGTGGGAACAGCCGCTCGAAAAGATCCTGCAGTCGGTCGAGGGCCCGGTCTCCAAGATCATGGCCGTCATCATCATCATCGTCACCGGCCTGACGCTGGCCTTCGGCGACAGTTCGGGCGGCTTC---AGACGGCTCATCCAGATCGTTTTTGGTCTCTCGATCGCCTTTGCGGCGTCGAGTTTCTTTCTGTCGTTCTTCTCG
KLAC_ECOLI/74-153 CCGGGCAGTGAGGGCGGCGGCCTGGGTGGCGGCCTGCCCTTCACTTCGGCCGTCGGGGCATTCACGGACTTCATGGCGGGGCCGGCAATTTTTACCTTGGGCATTCTTGGCATAGTGGTCGCGGGTGCCGTGCTCGTGTTCGGGGGTGAATTCAGCGGGTTCGTGCGATCCGTCTGCATGATGGTGATAGCCGTCAGCATGATTTTCGTGTCGTCGAACTTGGTGAAGGGCATTCTCGGC