EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04863 alignment
(6 sequences with 174 bp)


Q9M7L9_ALLCE/45-100 CTGACTTGGACTACCAAGGCAGCAACTGAGGCTGAGAAAGTGGCTGCTATATACTGTTCTGATCATGGCAGAGCTTATTTGGATGGAATACCA---GTTAATGGTGTC---CCTATATGTGAGTGTCATAATTGCTACAGCGGTCCTACTTGCTCCGTCTTGGCCTCAAATTGC
Q76BK3_ALLCE/47-102 AGAAGCTGGACATGGAAGGCAGCAAAAGAAGCTGAGGCTGTTGCTGCTATCAATTGTTCCAGCCATGGCAGAGCATTTTTGGATGGGATTATT---GCTGATGGAGCT---CCAATGTGCGAGCGTAATAATTGCTACAATGGTTCTGACTGCTCTACATTGCTTCCTAATTGC
O04927_ALLTU/30-85 CTAAGCTGGACCTTAAAGGCAGCAGAAGAGGCAGAGGCAGTGGCTGCTATCAAGTGCTCTGGTCATGGCCGAGCTTATCAGGATGGAGTTCTT---TCTAAAGGTTCT---CCAATATGTGAATGCAATACCTGCTACGAGGGTTCTGATTGCTCTACGAAGACCCCTAATTGC
ALLN2_ALLSA/27-82 ATGACATGGACTATGAAGGCAGCAGAAGAGGCAGAGGCGGTGGCTAATATAAACTGTTCAGAGCATGGAAGAGCTTTTCTGGATGGAATTATT---TCGGAGGGCTCT---CCTAAATGCGAGTGCAACACTTGCTACACCGGTCCGGATTGCTCTGAAAAGATCCAAGGTTGC
Q942G4_ORYSA/53-109 CTGAGCTGGGCACTGCAGGCGGCCAAGGAGGCCGAGGACGTGGCCGCCGTCGACTGCTCCGGCCACGGGAGCGTGTTCCTGGATGGCGTCACCGGCGAGGACGGGCGG---CCCGGGTGCGAGTGCAACAGCTGCTTCTCCGGTCCGGACTGCTCCGTCCGAATCCCCAACTGC
Q9FE98_ARATH/32-88 CCAACGTGGACCAATAGAGCCGCCTTGGAGGCAGAAGCTGCAGCCTCTGTTTCATGCTCAGGCCATGGCAGATCTTACGTGGACGGTCTTGGTGTCCTTGACGGCCATAAACCT---TGTGAGTGTCACGATTGCTACACAGGCAAAGATTGCTCCGTTCTTCTCAAAGATTGT