EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04831 alignment
(2 sequences with 462 bp)


POPD2_HUMAN/107-260 GAGTTTGACCTCCTCTACAAGACGCTGTGCCTGCCCTTGCAGGTGCCCCTACAGACATACAAGGAGATTGTTCACTGCTGCGAGGAGCAGGTCTTAACTCTGGCCACTGAACAGACCTATGCTGTGGAGGGTGAGACACCCATCAACCGCCTGTCCCTGCTGCTCTCTGGCCGGGTTCGTGTGAGCCAGGATGGGCAGTTTCTGCACTACATCTTTCCATACCAGTTCATGGACTCTCCTGAGTGGGAATCACTACAGCCTTCTGAGGAGGGGGTGTTCCAGGTCACTCTGACTGCTGAGACCTCATGTAGCTACATTTCCTGGCCCCGGAAAAGTCTCCATCTTCTTCTGACCAAAGAGCGATACATCTCCTGCCTCTTCTCGGCTCTGCTGGGATATGACATCTCGGAGAAGCTCTACACTCTCAATGACAAGCTCTTTGCTAAGTTTGGGCTGCGCTTT
POPD3_CHICK/107-260 GAATTCCAGGAACTCTACAGCGCTCTCTTCCAGCCTCTAGGAATTTCTTTAACTGTCTACAGGAAGATTGTCTTGTGCTGTGATGCAGAAGTGATTACCCTGGAGAAGGAGCACTGTTATGCTATGCAAGGCAAAACGCCTATTGACAAACTGTCTTTGCTTGTATCAGGCAGGATCAGAGTGACAGTTGATGGGGAGTTTCTGCATTATATTTTTCCTCTTCAGTTTCTGGATTCTCCTGAATGGGATTCACTGAGACCCACAGAAGAGGGAATTTTCCAGGTAACGCTTACAGCAGAGACAGATTGTCGGTATGTGGCCTGGAGGAGAAAGAAGCTGTATTTGCTGTTTGCTAAGCACCGTTTCATCTCACGCCTGTTCTCAATTTTAATCGGGAGCGACATCGCCGAAAAACTGTATGCCCTGAATGACAGGGTGCACGTGGGGAAGGGGTTTAGGTAT