EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04680 alignment
(2 sequences with 60 bp)


OGFR_HUMAN/577-596 ACCCCATCGGAGACCCCAGGCCCCAGCCCGGCAGGACCTACAAGGGATGAGCCAGCCGAG
OGFR_HUMAN/617-636 AGCCCATCGGAGACCCCAGGCCCCCGCCCGGCAGGACCTGCAGGGGACGAGCCAGCCGAG