EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04671 alignment
(43 sequences with 66 bp)


Q9U459_PLAFA/4317-4336 GGATCAATTACTGAAGAAATTCTACAA------GGATCAGTTACTGAAGAGTTTGTAGGACAACAA
Q9U459_PLAFA/2544-2564 GGATCTGCTACTGAAGAAATAGTACAA---GATGGATCAGGTACTAATGATTTTGTAGGAAAACAA
Q9U459_PLAFA/4396-4417 GGATCTGTTACTGAAGAAATATTAGAACATGAAGTGTCAGCAGATGAAAATTTTGTAGGACAAGCA
Q9U459_PLAFA/3852-3872 AAATCAGTTAATGAAGAAGTAGTAGAA---GACGGATTAACTATTGATGATTTTGTAGGATTACAA
Q9U459_PLAFA/3131-3151 GAATCAATTATAGAAGAAATAGTAGAA---GACGGATTAACTACTGATGATTTAGTAGGACAACAA
Q9U459_PLAFA/2782-2800 ------GTTACTGAAGAAATAGTAGAA---GACGGATTAGCTACTGATGAATTTGTAGAACAACAA
Q9U459_PLAFA/4232-4253 GTATCACCTTCTGAAGAAGTTATAGAAGAACAAGCATCAACTACTGAGGAATTTTTAGAAGAAAGA
Q9U459_PLAFA/3831-3851 GTATCAGTTACTGATGAAGTCGTAGAA---GAAGGTTCAACAACCGAAGAAGTTTTAGAAGAACAA
Q9U459_PLAFA/1465-1486 GGATCAGTTAGCGAAGAGGTATTAGAAGAAGAAGGATTCGGTACTGAAGAATTTGTAGGACAACAA
Q9U459_PLAFA/916-937 GGATCAGTTAGTGAAGAAGTTTTAGAAGAAGAAGGATCAACTACTGAAGAAGTTGTAGAAGAGCAA
Q9U459_PLAFA/4087-4108 AAATCAGTTATAGAAGAAGCTGTAGAAAAACAAGGATCTGTTACTGAAGAAATAGTAGAAGAAGAA
Q9U459_PLAFA/1563-1583 GTGTCAGCTTCTGAAGAAATAGTAGAA---GAAGGATCAGTTACTGAAGAAGTTGTAGAAGAGGAA
Q9U459_PLAFA/3743-3764 GGATCTGTTAATGAAGAAGTTGTAGAAGAAGAAGGATCAGTTACTGAAGAAATTAAAGAACAAGAA
Q9U459_PLAFA/2169-2190 GGATCAGTTGTTGAAGAAATTGTAGAGGAGGAAGGATCAGTTGTTGAAGAAATTGTAGAGGAGGAA
Q9U459_PLAFA/3478-3499 GGATCATATACTGAAGAAATATTAGAAGAAGAAGGATCATTTACTGAAGAAATATTAGAGGAAGAA
Q9U459_PLAFA/3456-3477 AATTCAGTTAATGAAGAAGTCTTAGAAGAAGAAGGATCATATACTGAAGAAATATTAGAAGAAGAA
Q9U459_PLAFA/2801-2822 GGATCTATTATTGAAGAAGTTCTAGATGATGAAGGATCAGTTACTGAAGAAATAGTAGAGGAAGAA
Q9U459_PLAFA/3383-3403 GTATCTGTTACTGAAGAAATAGTAGAAAAAGAAGGATCCGTTACTGAAGATATA---GGACAAGAA
Q9U459_PLAFA/2662-2683 GAATTAGTTACTGAAGAAATAGTAGAGGATGAAGGATCTTTTACTGAAGAAATAGTAGAGGATGAA
Q9U459_PLAFA/2618-2639 GAATCTGTTACTGAAGAAATAGTAGATGGAGAAGGATCATTTACTGAAGACATAGTAGAGGAAGAA
Q9U459_PLAFA/2492-2512 GGATCAGTAACTGAAGAATTAGTAGAT---GAAGGATCAGTTACTGAAGAAGTTGTAGAACAAGGG
Q9U459_PLAFA/1872-1892 GGATCGATTACGGAAGAAATTGTAGAA---GATGGATCAGCTAATGAAAAAATAGTAGAGGAAGAA
Q9U459_PLAFA/1103-1122 GGATCGTGTACTGAAATAGTTGTAGAA---AAAGGATCAGATACTGAA---ATTGTTGTAGAAGAA
Q9U459_PLAFA/2096-2116 GGATCAGTTATTCAAGAAGTTGTAGAA---GATGGATCAGTTACTGAAGAAATAGTACAAGAAAAT
Q9U459_PLAFA/2712-2732 GGATCAGTTATTAAAGAAATAATTGAC---GAAAAATCACTTACTGAAAAAATAGTTGAAGAAGAA
Q9U459_PLAFA/1946-1967 GAATCGATTAGTGAAAAAATAGTAGAAAAAGAAGAATCTGTTACTGAAGAAATTGTACGACAAGAA
Q9U459_PLAFA/2364-2383 GTATCAGTTAACGATGAAATAATAGAA---GATGCATCAGTTGCTGAA---GCAGTTGAAGAATCA
Q9U459_PLAFA/3916-3934 GGATCAGTTAACGAAGAAATAATAGAA---GAAGCATCAGTTGCTGAAGAAATAATACAA------
Q9U459_PLAFA/2984-3005 GGATCTGTTAATGAAGAAATTATAGAAGAAGTAGGCTCAATTACTGAAGAAATGGTAGAACAAGAT
Q9U459_PLAFA/3320-3340 GTATCAGCTTCTCAAGAAATAGTACAA---GATGGATCAGTTACTGAACAAATAATAGAGGAACAA
Q9U459_PLAFA/2409-2429 GGAGCGGTTACTGAAGAAATAGTTCAA---GATGGATTAATTACAGAAGAAATTTTAGAAGAATCT
Q9U459_PLAFA/3563-3584 GGATCTATTATTGAAGAAGTTCTAGAAGAAGAAGGATTAGATACTGAAAAAGTTTTTGAAAATGAA
Q9U459_PLAFA/3992-4012 GTATCAGTTGCTGAAGAAATAGTAGAA---GAAGAATTAGTTGATGATGAAATATTACCGGAGGAG
Q9U459_PLAFA/1593-1614 GAATCGGTTACTGAAGAAATAGTACAAAAAGAAGTATCAGATGCTGAAGAAGTTTTAGGACAAGAA
Q9U459_PLAFA/1009-1029 AAATCAGTTAATGAAGAAATAGAAGAA---ACAGATCTATCTACAGAAGAAATAATAAAACAACAA
Q9U459_PLAFA/4180-4199 TTGTCGATTAATAAAGAAGTTGTAGAA---ACTGAATCCCTCACTAAAGATATA---GAAGAAGAA
Q9U459_PLAFA/4013-4034 TTATCAGCTACTGAAGATGTTATAGAAGAAGTTAGATCAGTTACTGATGAAATAGTACAGGAAGAA
Q9U459_PLAFA/4109-4129 GAATTAGATACTGAGGAGGTATTAGAA---GATAAATCGGTTACTGGTGATGTTGTAGAACAAGAA
Q9U459_PLAFA/2597-2617 GAATCAATTAGAGAAGACGTTTTAGAA---GAAAGTTTGGTTACTGAAAATGTTGTAGGACAACAA
Q9U459_PLAFA/2440-2460 GAATCAGATGCTGAGGAAATTTTAGAA---ACAGAATTTCTTACTGAAGAAGTTGTAGGTCAAGCA
Q9U459_PLAFA/4045-4065 GTATCAGCTTCTGAAGAATATGTAGAC---GATAAATCGGTTACTGATGATTTTGTAGGACACGAA
Q9U459_PLAFA/1837-1857 CTATCAGGTTCTGAAGAAGTTCTAGAA---GACGAATGGGTTACTGATGCTTTTATGGGACAAGAA
Q9U459_PLAFA/3810-3830 GTAATAGATTCTGAAAAACTAGTAGAT---GCAGGATCAGTTACTGGGGAAGTTATGCCAGAAGAA