EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04608 alignment
(10 sequences with 558 bp)


O25437_HELPY/6-149 CTTCGTGCGTGTTTTTTAACCCTTTTTTTTAGCGGGTATTCTAAAAAAGCTCCTGGAACGATAGGGAGTTTAGTAGCGTTGTTATTAGGCTTACCCGTTTTAATTTTT---TCGGCTAAC---------------------------------------------------------------ACTTTGTTTTTAGGGGCGGTTTTTGTTGGGCTTATCGCTATCGCTCAAATAGATAAGGAAGAAGAAGAGACTAAGAGGCATGACAGCTCTTACATTGTGATAGACGAATTAGTGGGCATGTGGTTGGCGATGGCGATT------------------------------------------------------------AGCGGGTTATCGTTAGCGGGTGTGATCTTGAGTTTTATCTTTTTTAGGATCTATGATATTACTAAACCCTCACTCATTGGCAAGATAGATAAAGAAGTTAAAGGGGGCTTAGGGGTTGTGGCTGATGACGCTTTAGCGGGTGTTTTAGCCGGATTGAGCGCGTTATTAGTCATCCAT
Q9PM65_CAMJE/1-148 ATGCAAAAATTATTTTTAACTTTTTTTTATTCAGGTTCTGTAAAAAAGGCAAGTGGGACTTTTGGTACTATCGCTGCTTTAATACCTGCTTTTTTTATACTTAAATATCTCGGGATTAAT---------------------------------------------------------------ACTTTGTTTTTACTAAGCATTTTAATTTTTGTTGCAAGTATTCGTGTTATAGATGATTATGAAAAAAAAACAGGAATTCACGATGACAAACACATAGTTATCGATGAGGTTGCTGGAGTTTTTCTTGCTTGTGCTATTGCAGCA---------------------------------------------------AGTGTTGAAAACTCGATAGTCAATTTTATTTTGGCTTTTGTTTTATTCAGACTCTTTGACATTACAAAACCTTCTATTATTGGTAAGATAGATAAAAAAGTCAAAGGCGGACTAGGTGTAATGCTTGATGATATGTTAGCAGGATTGTTTGCTGGACTTTTAAGTGCGGTAATTTATGGA
Q9ZCJ0_RICPR/7-192 TTTTCAGAATTTTTTACTACTTTTTTTTACATAGGAAAAATAAAATATTGTCCAGGCACTTTTGGTTCGATTGCTGCTTTTCCTGTAACTTACAGTTTAATATATTTTGTTGTTCATCACAAAATAATTATTCCTTTCTCAAATCTTACTCTTGGCGAAGCTCAACTTGTCAGTATATTTATTATAAACTTTATTATATGTTTGATATTCTTAATGTTTGGTATTTATTTTACTAAAATATATTTAAATTATACAAATTTACAAGATCCCAAAGAAGTAGTAATTGATGAAGTAGTAGGACAAATGCTAACTATTGTTTTAGTATTTTTTTCTGCTTTATTTGCTAATGAATCACATTTAATGAAATATTATAGCCAATTAACAAGAAATATTATATTACTTTTTATATTACCTTTTTGTCTATTCCGATTTTTTGATATAGTAAAACCCTGGCCTATTAATTGGTTTGATAAAAATATTAAGGGAAGTATTGGTATTATGCTTGATGATTTACTTGCTGCAATATTTGCTGCGATAACTCAATACGCAATCATATTT
Q9HWX8_PSEAE/21-164 CCCTGGCATTTCCTCGCCTTCGGCTTCGGCTCCGGCACCCTGCCCAAGGCGCCGGGCACCTGGGGGTCGCTGGTGGCCATCCCGTTC---ATCCCGCTGTGGCAGATGCTGCCGGACTGG---------------------------------------------------------------GGCTACTGGCTGATGCTGGGAGTGACCATGCTGTTCGGCTCCTGGCTGTGCGGCAAGGTCGCCGACGACCTGCGCGTGCACGACCACGAAGGCATCGTCTGGGACGAGATGGTCGGCATGTGGATAACCCTCTGGCTGGTGCCG------------------------------------------------------------GAGGGCTGGTGGTGGCTGCTGATCGGCTTCGTCGTGTTCCGCATCGTGGATATTCTCAAGCCCTGGCCGATCAGTTGGGTGGACCGCAACGTGCACGGCGGCGTCGGGATCATGCTCGACGACGTCCTGGCCGGGGTATTCGCCTGGCTGGTCATGCAGGGTCTAGTCTGG
Q9KPU7_VIBCH/13-162 CCTTGGCACTTGCTTGCTACTGGTTTTGGCAGTGGCTTGTCGCCCATCGTGCCCGGAACGATGGGCACGTTAGCATCGGTGCCATTT---TATCTAATGCTGGCACAGCTCCCTTGGATT---------------------------------------------------------------CTGTATGCCGTCGTGGTTGTGTTCGCTAGCCTCATCGGCATAAAAATTTGCCAAGTCACCTCAGATGATATGCAGGTACACGATCACGGTTCGATTGTTTGGGATGAATTTGCCGGCTTTTGGATCACTATGCTGATTGTGCCG------------------------------------------TTATACCAATTACCGGTTTTCGATTGGAAATGGCTCGTGACAGGTTTTGTGCTATTTCGCTTTTTCGATATGCTCAAACCTTGGCCGATCAGTTGGTTGGATAAGCGTGTGCATGGCGGTTTCGGCATCATGATTGATGATTTAGTGGCTGGAGTAATGGCCGCGATAAGTTTAGCGGCCATCGGCTAC
PGPA_ECOLI/20-164 CCGTGGCATCTACTTGCTGTCGGATTCGGAAGTGGATTAAGCCCGATCGTTCCTGGGACGATGGGCTCGCTGGCAGCGATTCCGTTC---TGGTATCTGATGACCTTTTTGCCCTGGCAG---------------------------------------------------------------CTCTACTCGCTGGTGGTGATGCTGGGGATCTGTATCGGCGTCTATCTTTGTCATCAAACGGCGAAAGACATGGGTGTGCACGATCATGGCAGCATTGTCTGGGACGAATTTATTGGTATGTGGATCACGCTCATGGCGCTGCCG---------------------------------------------------------ACCAATGACTGGCAGTGGGTTGCCGCCGGGTTTGTGATTTTCCGTATTCTGGATATGTGGAAGCCGTGGCCGATCCGCTGGTTTGATCGCAATGTGCATGGCGGCATGGGGATCATGATCGACGATATTGTCGCCGGGGTGATTTCCGCAGGCATCCTGTATTTTATCGGTCAT
Q9CMT1_PASMU/14-159 CCCATTCATTTTCTCGCCCTCGGCTTTGGCGCCGGGTTGATTCGTCCTGCACCGGGAACATGGGGAAGTATGGTTGGTTTAATGCTTGGGTGGGGATTATTACAGTACTTGAACCTCGGT---------------------------------------------------------------TCTTTCTTTCTTTTCACCGCACTTTGTTTTGCTCTAGGGTGTTATCTTTGCCAGAAAACCGCAGAAGACATGGGAGTGCATGATCATGGGGCGATTGTTTGGGATGAAATTGTGGGGATTTTCGTTGTCTTGCTCTCACTTCCC---------------------------------------------------------AACTTATCGCCTTTCTGGTGTCTGACTGCGTTTATTCTGTTTCGTTTCTTTGATATTCTCAAACCTTATCCAATACGCTATTTTGATCATAAATTAGAAAGCGGGTTTGGCATTATGTTAGATGATATACTTGCGGCAATTTATGCAGTATTGGTGATTTTTATTTTACGTCTC
PGPA_HAEIN/15-160 CCTATTCATTTACTTGCCGTTGGTTTTGGCTCAGGCTTAATTCATCCTGCTCCCGGCACTTGGGGGAGCTTAGCTGGAACAATTTTAGGTGTGATTTTACTTTCCTTATTAGGCGTAAAA---------------------------------------------------------------ATCTTTTTAATTTTCACCGCACTTTGTTTTCTACTCGGTTGCTACCTTTGCCAAAAAACTACTGCAGATATGGGCGTACACGATCATGGTTCTATCGTCTGGGATGAATTTGTCGGCGTATTTATTGTATTAGCAGCGATACCG---------------------------------------------------------TCATTATCTTGGCAATGGATTTTGGCTGCTTTTGCGTTATTCCGCTTTTTTGATATTTTAAAACCGTTTCCAATTCGTTATTTTGACGAAAAACTCGAAAATGGTTTTGGCATTATGATCGATGACGTTTTAGCGGCAATTTATGCTGTGATTGTTGTATTTGCTATTCAATAT
Q9JRA8_NEIMA/15-160 CCGTTGTGTTTTTTGGCTTTTGGTTTCGGCAGCGGGCTGGCTCCGTTCGCGCCGGGTACATTTGGCACTTTGGCGGCACTGCCTTTGGCA---TTTGTGCTGATTTTGCTCGGCATAGAC---------------------------------------------------------GGGCTGCTGCTGGCTTTTTTGTGTATCGTGCTGTTTATGTGGGGCATACGCATTTGCGCTTATGCGGAACGTGAAACGGGTGTCAGCGACCATGGTGGGATTGTTTGGGACGAGATTGTCGCCATGCTGTTTGTGCTGGCGTTTGTGCCG------------------------------------------------------------TTCAGGTGGACGTGGTGGCTGGCGGCATTTGTCCTATTCCGTCTGTTTGACGCGCTCAAACCGTCTCCCGTCGGTTGGTTTGACAAGAATCTGCACGGCGGTTTGGGCATTATGGCGGACGATATGGCGGCTGCGGTGATGACTTTGATTGTCTTGAGGATTGCAATGCTG
O66655_AQUAE/4-145 ATTCTAGAGTTTTTAGCTACGGGTTTCCTCGTGGGAAAACTGCCCGTTGCCCCAGGAACCTTTGGAACACTTGTGGGAATTCCTTTAGTT------TTACTTCTTTACCTTGACAGGAAT---------------------------------------------------------------TTATACCTTTTTGGAACTTTAATTTTCTTTTTTCTCGGTTGGATTTCCTCGGAGTACATGGTTCAGAACTTAAGAGACGAAGATCCGGAACAGGTTGTTATAGACGAAATCGTAGGGTACTTACTGTGTTTCCTTTTTGTA------------------------------------------------------------GAACCTACCCTAAAATCCTTAATTCTCGCATTCATTATTTTCAGGGTTGTGGACATTCTTAAACCCTTTCCCGTGAACCTGTTTGAA---AACTTCCCCGGTGGACTTGGAGTTATGATGGACGATGTGGTGGGAGGACTGATCACTTCCGTGGTTCTTTATCTGTTATTACAA