EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04582 alignment
(4 sequences with 978 bp)


Q9J1B6_9REOV/1-326 ATGGCGGGTCTCAATCCATCGCAGCGAAGAGAGGTCGTCAGCTTGATACTGTCATTGACTTCGAACGTGACTATAAGTCATGGCGATTTGACGCCGATCTATGAACGGCTGACCAATCTAGAAGCGTCTACGGAGTTATTACATCGCTCCATTTCCGATATATCCACTACTGTCTCAAATATTTCTGCAAATTTACAAGACATGACCCATACCTTGGATGATGTAACTGCTAATTTAGACGGTTTGAGGACCACTGTTACTGCACTTCAGGATTCCGTCTCCATTCTGTCTACAAATGTGACTGACTTAACGAACACATCCTCTGCGCACGCGGCGACACTATCTTCACTTCAAACTACGGTTGACGGAAACTCCACTGCCATCTCCAATTTGAAGAGTGATGTATCGTCGAACGGTTTAGCTATTACAGATCTGCAGGATCGTGTTAAATCATTGGAGTCTACCGCGAGTCATGGTCTATCTTTTTCGCCTCCGCTTAGTGTCGCTGACGGCGTGGTTTCATTAGACATGGACCCCTACTTCTGTTCTCAACGAGTTTCTTTAACATCATACTCGGCGGAGGCTCAACTAATGCAATTTCGGTGGATGGCACGGGGTACTAACGGATCATCTGATACCATTGACATGACCGTTAACGCTCACTGTCATGGAAGACGCACTGATTATATGATGTCGTCCACGGGAAATCTCACGGTCACTAGTAACGTCGTGTTATTAACCTTCGATTTAAGTGACATAACGCATATCCCATCAGACCTAGCACGTCTTGTTCCCAGTGCGGGATTCCAAGCTGCGTCGTTCCCTGTGGACGTATCATTCACCCGCGATTCTGCGACTCATGCGTACCAAGCGTATGGGGTGTACTCGAGCTCACGTGTCTTCACAATTACTTTCCCAACCGGAGGTGATGGTACAGCGAACATTCGTTCCTTGACCGTGCGTACCGGCATCGACACC
Q9DPB5_9REOV/1-326 ATGGCGGGTCTCAATCCATTGCAGCGAAGAGAAGTCGTCAGCTTGATACTGTCATTGACTTCGAGCACGACTACAAATCCTGGCGATTTGACAGCAGTCTATGAGCGGTTGACCAATTTGGAGGCGTCTACGAAGTCATTGCGTCAATCCCTTTCCAGCATAGTCTCTGATTTGTCTGATGTTTCCGTTGATTTACAAGATACGACGCGTGCCTTAGACGACGCGATCGCTACTTTAAAAGGTCTGAATACCACTGTCGCTGCGCTCCAGAATTCTGTAGCCTCTCTATCCTCAACTGTGAATGGGCTAACAGATATTTCCTCCGCCCATTCGGAAGCGCTATCATTTCTGCGAACTACGATAGATGGGAACACAGTTGCGATTTCTAATTTGAAGGGTGACGTGTCGACTAATGGCTTAAATATTGCGGACCTCCAGAATCGCATGAAATCGTTAGAGTCCAGTACGAGTCATGGTTTATCGTTTTCACCTCCTCTTAGCGTTGCTGACGGCGTGGTGTCACTGGATATGGATCCTTACTTTTGTTCTCAACGCGTTTCGTTAACTTCATATTCAGCGGAGGCTAAACTGATGCAATTTCAGTGGATGGCGAAAGGCACTAGTGGTTCATCTGATGTCATCGATATGACTGTCAACGCTCACTGTCATGGGAGACGCACTGACTACATGATGTCATCTACTGGAGGCCTCACAGTCACTAGCAATGCCGTATCTTTGACCTTCAGCTTAGATTATATTACCAATATGCCTTCAGATTTATCACGTCTTATTCCCAGCGTAGGATTTCAAGCTGCATCGTTCCCTGTGGATGTGTCATTCACCAGAGATTCTGCGACTCATTCCTACCAAGTGTATGGAGCGTACTCAAGTGCGCGTGTCTTCACAATCACTTTCCCCACTGGTGGTAATGGTACATCGAACATTCGTTTCCTAACCGTGCGTACCGGCATCGACACT
Q9DPB4_9REOV/1-326 ATGGCCGGATTAACTCCCTCACAGCGAAGAGAAGTCGTGGGATTGATACTCTCCTTGACTTCGAGCGCGAATACAAACTGTGGAGATTTGACGCCTGTTTATGATCGCCTACTTAGTCTGGAGTCCGCCGTTGCGTCATTGGATGGTTCTGTTGGTGTCTTGTCACAGAAGGTATCAGATTTAGAATCCGACTTACAAGGCGTTGTTTCATCTCTAGGTCAGGCCAACTCAACGTTGACCGAGTTATCTAAGGAACTACGTCAGCTGAGCAGCTCTGTCGACAACCTCATGACGTCTCTTTCAGATCTATCGACCACTGTGTCCGGGAATCAGGCTGCGATAGCTGGTATACAAACTTCTGTTCATGCTAATACGACTGACATTAGCAACCTGAAAAGCAGCGTATCTGCTATTAGCTTAAATATCACTGATCTCGAGCGGCGTGTGGGAGACATTGAGTCAGGCTCAGGCCCCAATTTGAGATTTGTGTCGCCCCTGAGTTTGTCCCAGGGTGTAGTGTCGCTGGTTATGGATCCTTATTTTTGTTCGGACAATCAAGCGTTGACCTCATATTCTACAGACGCTCAGTTGATGCAATTCCAGTGGTTGGCTAGAGGTGAGGATGGTTCATCGAGCTCTGTTGACATGCTCGTTAATCGGCACTGTCATGGGCGTCGCACTGACTATATGATGTCCACTACGGAAAGTTTCACCGTCACAGGTAACTCGGTGTCATTGGTTTTCAATCTGGACTATATTACCAAACCGCCGTCTGACATGTCGCGTTTAGTACCACGTGCTGGGTTCCAGGCTGCTTCTTTTCCCGTGGACGTTTCTTTCACTCGTGACACAACAACCCATGCTTACCAGGTGTACGGCGCTTTTTCTAGTCCTCGTGTCTTTAAGATTACGTTCCTCACAGGTGGTACTGGGACTGCGAATCTCCGTTTCTTGACCGTGCGTACGGGCATCGACACT
Q83931_9REOV/1-326 ATGGACGGATTAACTCAACAGCAGCGAAGAGAAGTCGTGGGGTTGATACTGTCATTGACTTCGAGCGTGACTATAAATCCTGGCGATTTGACTCAAATCCGTGAGCGTCTCTCTGCTCTAGAATCTGCGAATGCATCGTTGAGCGAGTCCGTTAACACGGCTTTGTCTAGATTGACGGATTTGTCTGCGGCGCTTGGCAATATGGCGACGTCGGTAGCAGAGATGAAAGTAGAATTGAATTCGTTAATTTCTGATGTTCAGGCCTTACGCACTTCCTTGGATTCTTCCTCTTCGGAACTGGCGTCTTTATCCTTATTGGTGCATGATCATGATTCTTCGATTTCTGATCTACAAAAGGAAAGTCATGCGTTATCGGGTGATATAACTAACCTTAATTCCTCAGTGTCAGCGCAGGGGCTTACTATTTCTAGCCTCGAACAACGCGTCCAGGCGCTAGAAGGGGGTTCTAGTACGAGTCTCTTATTTGCTGATCCTCTCAAGTTAGAAGCTGGGACTGTGTCATTAGAACTGGACCCATATTTCTGCTCTGTAAGCCGTAACTTGACATCGTATTCCGCTGACGCCCAATTGATGCAATTCCAGTGGTCTGTGAAAGGGGAAGATGGTGCTACAAATTCTATTGATATGGATGTGAATGCTCATTGCCATGGGCCACGTACCGATTATCTCATGTCAACTAAGCAATCGTTGACTATCACGGCATCCCCCGCCACTCTCGTCTTCGAACTCGACAGGATTACGAAGCTTCCTCCTGATCTCTCACGTCTGATTCCATGTCACGGTTTCCAGCAAGCCACTTTCCCCGTTGACATCTCTTTTCAACGTGACGGCGTTTCTCACTCATACCAGGTCTATGGGACATACACATCCTCTCGCGTCTTCAAGATTACATTCTCGCCAGGCGCTTCAGGTCCCGCGGTGATTCAATTCCTGACCGTGCGTACGGGCATCGATACC