EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04376 alignment
(11 sequences with 348 bp)


ATE_CAUCR/8-96 CGACAGCTTCGGTTCTTTCTGACGGCGCCCACGCCTTGCCCGTACCTGCCCGGTCGCGAGGAGCGGAAGGTC------------------------------------------------------------------------------TTCGCCCACCTGCCGCTGTCCGACGGCCCCATCGTCAATGACAGCCTGACCCAGGTCGGCTTTCGCCGCTCCCAGAACATCGCTTATCGCCCCGCCTGC---GAGACATGCCGTGCATGTCAGTCCGCTCGCGCGCCGGCGACGGAGTACATCCTGTCGCGCTCCGAGCGAAAGATCCTCGGCCGCAACGATGATCTG
ATE_RHILO/7-95 CAGTCGCCGCAGTTCTTCCTGACCGCGCCGTCGCCGTGCCCCTATCTCGACGGCCAGTTCGAGCGGAAGGTG------------------------------------------------------------------------------TTCACGCATCTGGTCGGCGACAAGGCGTCGGAGATGAACGACCTGTTGACGCAAGGCGGCTTCCGGCGGTCACAGAACATTGCCTACCGGCCGGCCTGC---GAGACCTGCCGCGCCTGCGTTTCGGTGCGCATCCTCGCCCAGGAATTCACCGCCAGCCGCAACATGAAGCGTGTGCTGCAGCACAATTCCGACCTC
ATE_PSEAE/5-93 GCCCGACTGAAGTTCTACGCGACGCAACCGCACCCGTGCAGCTACCTGCCCGAGGAGCAG---GCAACCACCCTG---------------------------------------------------------------------------TTCCTCGATCCCAGCCAGCCCATGGACACGCAGCTGTACGCCTCGCTGTCGGAGGTCGGCTTCCGCCGCAGCGGCGACCATCTCTATCGTCCGCACTGC---CAGCATTGCACCGCCTGCATCGCCGCGCGCATACCGGTCGCCGACTTCAGCCCGAACCGCCAGCAGCGGCGCATCCTCAAGCGCAATGCGGAACTG
ATE_XYLFA/9-97 GACGACCTACAGCTATTCAAGACCAACCTTCACCCATGCGGTTACTGGCCGGACAGATGGGCAAGCGATTTG------------------------------------------------------------------------------GTCATGGACCCAAACGACCCCCGCCTGGGTGCCATCTACCCACAAGCCCTGGCTTGGGGCTTCCGCCGCTCCGGCAACCTGCTGTACAGACCACACTGC---GAACACTGCAATGCCTGCGTCCCAGTACGCGTCAATGTCAATGCTTTCGTTCCAAATCGCAGCCAGCGTCGCTGCCTGGCCCGCAACGCCACGCTT
ATE_VIBCH/6-94 CAGCAAATTCGTATTGGCTTAACCAATAACCATCCTTGTAGCTACTTAGCGGATCGGATG---GAGCGCGTCGCC---------------------------------------------------------------------------GTGGCGATTGATCCGCAGATGCAAACCCCCGAAACCTATGAAGTGCTGATGGCAAATGGTTTTCGGCGCAGCGGCGATACCATCTACAAACCGCATTGT---GATCATTGCCAGTCTTGCCAAGCTCTGCGAATTCCTGCGCCCGATTTTGTGCCAAGTAAAAGCCAAAAACGTTTACTCAAGCTGCTCAGCCAAGAG
ATE_CAMJE/1-88 ATGCTTGAGATTGGTTTTTGTACTCTTGAAGATCAGTGTCCTTACTTAAAGGATAAACGTTCAAGAATAGAGTAT---------------------------------------------------------------------------------AAATACATTGAAAATTGCCCTAAAGAAATCAATAATGAGCTAATAAAACGAGGTTGGCGTCGTTTTGGTAGGTATTTTTCACGCCCTATTTGT---AAAGATTGTGATGAATGTTTAAGTCTTAGAATTTTAGTTAATGAATATAATTTTTCAAGAAGTGAAAGAAGGGTTGTAAATAAAAATATTAACACC
ATE1_DROME/4-93 AGCATTGTGAGTTACTATGGCAGCCAGCAGAGCAAGTGCGGCTACTGCGCGGGAGCGAACTGCAGCCTGTCG------------------------------------------------------------------------------CACGGTATGCACGCGTATCAGCTGGACTGCCGGGACTATCAGGACCTCATCGATCGCGGCTGGCGGCGGTGCGGCTACTACTGCTACAAGCTGCGCAACCAGGAGACCTGCTGCCCCTGCTACACAATCAAATGTAATGGCCTGGAGTTCAAGCTCTCCAAGTCGAACAAGCGCATACTTCGCCGCATAAATCGATTT
ATE1_HUMAN/16-100 CCTAGCGAGGACTTCTAC---------------CGCTGCGGCTACTGCAAGAACGAGTCGGGCAGCCGCTCC------------------------------------------------------------------------------AATGGCATGTGGGCACATTCCATGACAGTACAGGATTATCAGGATCTCATAGACCGAGGATGGCGAAGAAGTGGAAAATATGTGTACAAACCTGTCATGAATCAAACATGTTGTCCTCAGTACACAATAAGGTGCCGACCTTTACAATTTCAGCCTTCAAAATCTCACAAGAAGGTTTTGAAAAAAATGTTGAAATTT
Q9C776_ARATH/23-113 AGTATAGTCGCTGATTGTGGACGAAATAAATCAACTTGCGGTTACTGTAAATCTTCTACCCGCTTTAGTATTTCT---------------------------------------------------------------------------CACGGTTTATGGACAGAGAGACTCACCGTTAATGACTATCAAGCTCTTCTTGACAGTGGATGGAGACGATCTGGCTGCTATCTTTACAAACCTGAGATGGAGAAGACTTGTTGCCCTTCTTATACAATCCGCTTGAAAGCAAGTGATTTTGTCCCTTCTAAGGAGCAGCAGCGAGTGCGTAGAAGAATAGAAAGGTTT
ATE1_ARATH/19-109 AGCGTAATCGATGATCATGGCCGCCGTAAAAGCACTTGCGGCTACTGTAAATCCCCAGCTCGGTCCAGTATCTCT---------------------------------------------------------------------------CACGGTTTATCAGCACAGACTCTTACCGTTTATGACTACCAAGCTCTTATTGACCGAGGCTGGAGAAGATCTGGTACTTATCTTTACAAACATGAGATGGATAAAACGTGTTGCCCTCCTTATACGATACGTTTGAAAGCAAGTGATTTTGTTCCTACTAAAGAGCAGCAGCGAGTTTCTAGAAGACTAGAAAGGTTC
ATE1_YEAST/8-123 TGGGCTCCCTCGATGCACAATGAACCTGCCGCAAAGTGTGGGTATTGTCACGGTAATAAGGGGGGCAACATGGATCAGTTGTTCGCATTGGATTCGTGGGCTCATCGTTATATGAACAAAATGGACGTTGTAAAGATTGAAAACTGCACAATTGGCTCTTTCGTGGAACATATGGATGTAGCCACGTATGATCGCATGTGTAATATGGGATTTAGAAGGTCTGGTAAGTTTCTTTATAAAGTGGACCCGTTGAGGAATTGTTGTAGGTTATACACCATTCGAACTGCCCCTCAAGAATTGAATATGACAAAGGAATTGAAAAAATGCATCAGCCGCTTTGCTACTAGA