EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04350 alignment
(4 sequences with 453 bp)


Q9PGD1_XYLFA/51-201 CTTGGTGTGCTTGAAGGTAAAGAGCGCGAGCTGCGTTCGGAATTCCAAAAGCAGCAGGAACGTGCTGTGAACCTGCAGCCATTAAAGCAACAGTTGGTGCAGATGGAAGAGGTGCTGAAGCAGATGTTGCGGCAGTTGCCTAGTAAGACCGAAATGCCCGATCTGATTGTTGACATCTCTCAGACTGCCTTATCTAGTGGCTTGGTGAATGAGCTATTTCAACCAGGTGATGAAGTTCTTAAGGAGTTTTACGCTGAGAAGCCGATTTCTTTACGTATGGTTGGGAGCTATCACCAGTTTGCTGCTTTTGTTAGTGGCGTGGCTTCTTTACCGCGCGTAGTGATTTTGACGATGCATGATATGAGTCTCAAACCGAAAACCAATAAGAACAATGTGTCTACGCGAGGTTTGCTTGAATTGTCTGGCACAGTCAAAACTTACCGCTACTTGGAT
Q51353_PSEAE/58-202 CTCGAACAGCAGGCCGCGGAAGAGGAGACGCTCAAGCAGCAGTTCTCCACCAAGGCCTTCCAGGCCGCGAACCTGGAAGCCTACAAGGCACAGATGAAGGAGATGGAAGAGTCCTTTGGCGCCTTGCTGCGGCAGTTGCCCAGCGACACCGAGGTACCCGGGCTGCTCGAGGACATCACTCGTACCGGCCTGGGCAGCGGCCTGGAGTTCGAGGAAATCAAGCTGCTTCCCGAGGTTGCCCAGCAGTTCTACATCGAGCTGCCGATCCAGATCAGCGTGGTCGGCGGCTACCACGACTTGGCGACCTTCGTCAGCGGCGTGTCCAGCCTGCCGCGG------ATCGTCACCCTGCATGACTTCGAGATCAAGCCGGTCGCGCCC------GGCAGCACGTCCAAG------CTGCGCATGAGCATCCTGGCCAAGACCTATCGCTACAACGAC
Q9KNU8_VIBCH/50-193 ATTGCGCTGTTAAAGCAGGAAGAGGAAACCGTCAAGGCGACACTGCGCATCAAAGCCAATAAAGTGGCGGTATTGCCGCAGATCCAAGCTCAGTTGGACGAGCTCAAAGAGCGTTACGATTTTTTACTGCGCCAGCTACCGGTGCAAAAAGAGTTAGCCAGCATGCTGGCGTCAGTCAACCAGCTTGGGCTCGATAGTTCGCTTACCTTTACGCGGATTGATTGGGGGGAGCGTGAAAGCCAAGAGTTTCTTTACCGCTTACCGCTCAATATCGAACTGACGGGGAGCTATCACGATATTGGCGATTTTTCGCAAGCGATTGCCAAGTTACCGCGC------ATCATCAACTTCGACGATGTGGACTGGCAGCGTGTCAGCCAA---------------GAGAGTAGCACGCTGCACTTTCGAGTCAGAGCCTACACCTACCAATTTAAGCAG
Q9JR13_NEIMA/50-200 CTTGAGGAATACGAAGCAAAAGAAACCGAACTGAAAAACACCTACAAACAGAAAAGTATCGACGCGGCCAGCCTGAACAACCTGAGGGACGAACTTGCCTCAATCCGCTCTGCCTTCGATATCATGTTGAAACAGCTGCCGACAGATGCAGAAATTCCCAACCTGGTTCAAGAGCTTCATCAGGCAGGTTCGAGCAACGGCCTGCGCTTGGACAGCGTTATGCCCCAACCTCCCGTAGATGACGGCCCCATCAAAAGATTACCCTATTCCATTTCCATTACCGGAAATTACGAACAGATCAGCCAATTTACCCGCGATGTCGGCAGCCTCTCCCGAATCATTACCCTTGAGTCGCTGAAAATCGCCCAATCTCCGGAAAACGGCGGCAATCCTGACGGCAAGAGCAGCATCCTGAACCTCAGTGCCATTGCCACCACCTACCAAGCAAAATCC