EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04344 alignment
(2 sequences with 717 bp)


Q9KQD6_VIBCH/1-239 ATGATTTCATTAGAACAGGCTAAAGAACTCGTGCAACTTTTGGAACAAGGACGTCAAGACGACGCTAATCGCCTTTTCACCTATGTCTACGAGTCTGCCAATAACCCTATGTTTAAAGAGATAGGGATGCTGACGCGAGACTTACACGAAGCGCTGAAAAACTTTCAGATTGATGAGCGCTTCAGTGAAATCGCGACGGATGAAATTCCAGACGCACGGGAAAGACTGCATTACGTTATACAGAAAACGGAAGTCGCAGCGAACAAAACCATGGATGCAGTGGATCGGTGTATGCCGATAGCCGACAAACTACATGAAAGCTTGCTGCTGATTCGCCCTGAATGGAATGGCTTGATGAATGGTCGGATTGAACTGATGCACTTCAAGTCACTATGCCACCGGATTGATGACTTGCTCTCGCAAGTAGAAGGCGACAGCAGTGAATTGCGTGGTGAATTGACTGAGATCCTGATGGCTCAAGACTTTCAAGACCTGACAGGACAAATCATCAAACGTGTGATTAATCTGGTCAATGAGGTTGAAAAACGTTTAGTCGAAATACTGACGGTTTTTGGCGCAGCGCAAAAAGAACAAAAAGCAGACAAGGCGACAGTGGCATCAATAGAACCAGAGGGGCCGATTCTCAATCCTCATGAACGAATTGATGCTGTCTCATCTCAAGACGAAGTTGACGATCTGTTATCGAGTCTTGGATTT
CHEZ_ECOLI/3-214 CAACCATCAATCAAACCTGCTGACGAG------------------------------------------------------------------CATTCAGCTGGCGATATCATTGCGCGCATCGGCAGCCTGACGCGTATGCTGCGCGACAGTTTGCGGGAACTGGGGCTGGATCAGGCCATTGCCGAA---GCGGCGGAAGCCATCCCCGATGCGCGCGATCGTTTGTACTATGTTGTGCAGATGACCGCCCAGGCTGCGGAGCGGGCGCTGAACAGTGTTGAGGCGTCACAACCGCATCAGGATCAAATGGAGAAATCAGCAAAAGCGTTAACCCAACGTTGGGATGACTGGTTTGCCGATCCGATTGACCTTGCCGACGCCCGTGAACTGGTAACAGATACACGACAATTTCTGGCAGATGTACCCGCGCATACCAGCTTTACTAACGCGCAACTGCTGGAAATCATGATGGCGCAGGATTTTCAGGATCTCACCGGGCAGGTCATTAAGCGGATGATGGATGTCATTCAGGAGATCGAACGCCAGTTGCTGATGGTGCTGTTG---------GAAAACATCCCGGAACAGGAGTCGCGTCCAAAACGTGAAAACCAGAGTTTGCTTAATGGACCTCAGGTCGATACC---AGCAAAGCCGGTGTGGTAGCCAGTCAGGATCAGGTGGACGATTTGTTGGATAGTCTTGGATTT