EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04303 alignment
(8 sequences with 1173 bp)


YRAM_BACSU/1-361 ATGGTCAAGACGAATGTAACAATCATGAGAGGCGGAACAAGCAAAGGCGTTTTTTTCCACGAATCAGCCATGCCTAACAATAAA------------AACGAATGGGAGCCCTTTTTGCTTGATGTCATGGGAAGTCCTGATAAAAGA------CAAATAGATGGTTTGGGTGGCGGTAATTCCCTTACTAGTAAAGTGGCAATAATAAAGAAAGCATATACTTCGGATATTGATGTTCACTATACTTTCGGTCAAGTCAGCATTTCGGAAGAAAAGGTGGACTTTAAGGGGAACTGCGGAAATATCTCCGCTGCTGTTGGTCCATTTGCTATTGAAGAAGGACTTGTA---AAAGCGAAAGAACCA---------ATGACTGCGGTAAGGATCCTGAATACCAATACGAATAAAATGATCATTGCGGAAGTAGAAGTGGAAGACGGTCAGGTCAAATATGACGGAGATGTTACGATATCTGGAGTACCTGGATCTGGATCTCCAATCTATTTAAACTTTCATGATGCCGCTGGTTCAGTTACC---...GGTCATTTATTGCCTACTGGAAATAGTTCGGAGTTTTTAGATACAAGTCAA---GGCCAAATAGAGGTGTCTATTATCGACTATGCAAATCCATTAGTTTTTGTGGAAGCGAGCAGTATCGGCCTGGATGGAACGGAACTTGCAGAAGAATTTACT---GATCTACAG---TTGGCTCAATTTGAAGAATTAAGATCCATTGCGGCAGAGAAATGCGGCTTTGCCAGTCGATTTTCAGCTACAAAGTTATCGCCGGCTGTCCCCAAACTGGCTATAGTAGCAAAACCAGAGAAATATAAAGATAGTACAGGTGCTTGGCATTCAAGCGTTGAGATGGACTTACACATCAGGATGATGTCCATGCAAAAGTCACATCAAGCACTGGCTGTCACTGGAGCGATATGTACAACAAGAGCCCTTTCAGTGGAAGGTGCAATCCCTGCAAGAATAGCA------AAAAACCACTCT------ACAAAGGTTCGGCTAGCTCATTCTTCTGGT------ATTATTGAAACAATGGTGGAGCCCACTGGT---------------------------ATAAAGATCGTCCGTACCGCACGACGTATTATGGACGGAACAGTTTATACGCAT
Q9L3A0_9SPHN/7-356 CACGCCAGCGCCCGCGTCATGTGGATGCGCGGCGGCACGTCCAAGGGCGGCTATTTCCTGGGCGAAGACCTGCCAGCCGACGCG------------GCTGCGCGCGACGCCTTCCTGCTGCGCATCATGGGGTCGCCAGATCCGCGC------CAGATCGACGGCATGGGCGGCGCCGACCCGCTGACCAGCAAGGTCGCCGTGGTCAGGAAATCGCAGCGGGAAGGCGTCGACGTCGACTATCTTTTTCTCCAGGTCTTCGTCGACCAGGCCATTGTCAGCGACGCGCAGAATTGCGGCAATATCCTGGCCGGAGTCGGCCCCTTCGCCATCGAACGCGGACTGGTC---GCGGCACGGGACGGC---------GAAACCCGCGTCGCCATCTTCATGGAAAATACCGGGCAGATCGCCATTGCGACGGTCGAAACGCCCGGCGGCAGGGTTTGCTATGACGGGGAAGCGAAGATTGATGGCGTGCCCGGTTCCGCCGCGCCGATCCCATTGGAGTTCCGCGACACCGCCGGTTCGTCCTGC---...GGCGCGCTGCTCCCCACCGGCAATGCCTGCGACGAGGTGGAGGGC---------------GTGCGCGTCACGCTGATCGACAATGGCATGCCCTGCGTCGTCATGAAGGCGCAGGATGTCGGGATCAGCGGTTATGAGGATCGCGAGACGCTGGACAATGACCTCGGGCTCAAGGCCCGGATCGAGGCGATCCGCCTCGCCGTGGGAGAACGGATGAAC---CTGGGCGACGTCAGGGAAAAGTCC------------GTCCCCAAGATGATGCTGGTCGCACCACCCAGG------------AATGGCGGA------------------GCGGTCACG------GTACGCAGCTTCATCCCGCATCGCGCCCACGCCTCGATCGGCGTGCTGGGCGCGGTCAGCGTCGCCACCGCCTGCCTGATCGACGGATCGCCCGCCGCCGAAGTGGCCAGCATTCCCCGCGGCCGC---CGCAAGACCCTTTCGGTCGAGCATCCGACGGGCGAGACCACTTGCGTCATGGAACTGGATGAAAGCGGC---------------GCGGTGACGAGTGCGGCCATGCTGCGCACGGCGCGCAAATTGATGGATGGAGAGGTTTTCGTA---
YBHH_ECOLI/1-350 ATGAAAAAAATACCCTGCGTGATGATGCGAGGTGGAACCTCGAGGGGCGCGTTCCTGTTAGCGGAACATTTACCCGAAGATCAA------------ACGCAGCGCGATAAAATATTGATGGCAATTATGGGTTCCGGTAACGATCTG------GAAATTGACGGTATTGGCGGCGGTAATCCACTGACCAGTAAAGTCGCCATTATTAGCCGTTCCAGCGATCCGCGTGCTGATGTCGATTATCTGTTTGCGCAGGTAATCGTTCATGAGCAACGTGTCGATACCACGCCTAACTGCGGCAATATGCTGTCTGGTGTTGGGGCATTCGCCATTGAAAATGGTTTGATT---GCAGCGACTTCGCCA---------GTTACTCGCGTACGTATCCGCAACGTCAATACGGGTACGTTCATCGAAGCTGATGTGCAAACGCCAAATGGTGTTGTCGAGTACGAGGGTAGCGCCAGAATTGACGGCGTACCGGGTACTGCCGCACCGGTTGCGCTCACTTTCCTGAATGCCGCTGGAACCAAAACC---...GGAAAAGTTTTCCCGACTGATAATCAGATTGATTATTTTGACGAT---------------GTCCCGGTGACCTGTATCGATATGGCGATGCCAGTCGTCATTATTCCGGCTGAATATCTGGGAAAAACAGGTTATGAATTACCGGCGGAACTGGATGCCGACAAAGCATTATTAGCCCGCATTGAATCTATCCGTCTACAAGCGGGTAAAGCAATGGGC---TTAGGTGATGTCAGTAATATGGTT------------ATCCCTAAACCTGTGCTTATTTCTCCAGCGCAG------------AAAGGCGGG------------------GCAATTAAT------GTGCGTTATTTTATGCCGCATTCTTGCCATCGCGCGCTGGCGATAACCGGTGCTATTGCTATTTCCAGTAGTTGTGCATTGGAAGGCACCGTCACCCGACAAATCGTC------CCTTCTGTAGGA---TACGGCAATATCAATATTGAACACCCCAGTGGT------GCGCTCGACGTTCATTTAAGTAATGAAGGTCAGGATGCC------ACGACGTTACGCGCATCTGTTATTCGGACGACCAGAAAAATATTTTCCGGTGAAGTTTATCTTCCC
Q987N7_RHILO/9-356 CTCCTGGCGATCCCTTGCGTTCTGATGAGGGGCGGCACCTCAAAAGGTCCGTTCTTCCTGGCAAACGATCTTCCCGCGGACGCT------------ATAGAGCGGGACAAGATCCTGCTCTCCGTCATGGGCTCGGGTCATCCGTTG------CAGATAGACGGCATCGGTGGCGGCAATCCGGTCACGAGCAAGGTCGCCATCGTCGGCCCTGCCAGCATTCCAGGCGCCGACGTGGATTATCTGTTTGCGCAGGTGCGGGTCGACCAGCAGATTGTCGACACCTCCCCGAATTGCGGCAACATGCTGGCCGCGGTCGGCCCGTTTGCCATTGAAGCTGGACTTGTG---CCGGTTCGTGGAGAA---------ACGACGCTGGTGCGGATCCACAACGTCAACACCAGCAAGCTGATCGAGGCCGAAGTTCCCACTCCAAACGGCAGCGTCTCCTATCTCGGTGAAGCTGCGATTGACGGCGTGCCCGGCCGCGGGGCTCCGATCGCATTGACCTTCATGGATGCAGCCGGTGCCCGTACC---...GGACAGCTTTTTCCCACCGGCAATCCAGTCGACACGATCGATGGT---------------GTGGCTGTCACCTGCATCGACTGCGCAATGCCGATGATATTGATCGAGGCCGACTCGGTCGGCGCAACGGGTTTCGAATCAGCTGCGGAACTGAATGCTGACAAGGAATTACTGGGACGTCTGGAAAAGCTGCGCATCGCCGCCGGCGAACGGATGGGT---CTTGGAGACGTTCGCGACCAGGTA------------ACGCCGAAGCCGGTGCTCATTTCCCGGCCGACG------------TCTGGAGGC------------------GATATCAGC------GTTCGGTATTTCATGCCTCATCAATGTCATCCCTCGCTCGCAACCACGGGTGCCGTGGGTATCGCGACAGCCTGTATCAGCCAGGGTACGGTTGCTTCGCTGCTGATC------GGCCTGCGTGCGCCGCCAGTCGTGCTGTCCATCGAGCACCCAAGCGGC------CATCTGGACGTCAAGCTGTATGAAAGAGAC---------------GGCAAGGTCGTCGCCGGAATCCTCCGCACCGCCCGCCGGCTGTTCGAAGGACATGTGTTCGCAAAA
Q9JT06_NEIMA/3-385 CAAATTAAAATTCCCGCCGTTTACTACCGTGGCGGTACATCAAAAGGCGTGTTTTTCAAACGTTCCGACCTGCCCGAGGCGGCGCGGGAAGCGGGAAGCGCACGCGACAAAATCCTCTTGCGCGTACTCGGCAGCCCGGATCCCTACGGCAAGCAGATAGACGGTTTGGGCAACGCCAGCTCGTCCACCAGCAAGGCGGTGATTTTGGACAAGTCCGAACGCGCCGATCACGATGTCGATTACCTTTTCGGGCAAGTTTCCATCGACAAACCTTTTGTCGATTGGAGTGGCAACTGCGGCAACCTCACCGCCGCCGTGGGCGCATTTGCCATCGAGCAAGGCTTGGTCGATAAAGGCAAGATTCCTTCAGACGGCATCTGCACAGTCAAAATCTGGCAGAAAAACATCGGCAAAACCATTATTGCCCATGTACCGATGCAAAACGGCGCAGTTTTGGAAACAGGCGATTTTGAGCTCGACGGCGTAACGTTCCCGGCAGCCGAAGTACAAATCGAATTTCTTGATCCAGCCGACGGCGAA------...GGCAGTATGTTCCCAACCGGCAATTTGGTCGATGAAATTGATGTGCCGAATATAGGCCGTTTGAAAGCCACGCTCATCAACGCGGGCATTCCGACCGTTTTCCTGAATGCCGCCGACTTGGGCTACACGGGCAAAGAGTTGCAAGACGACATCAACAACGATGCCGCAGCTTTGGAAAAATTCGAGAAAATCCGCGCTTACGGTGCGCTGAAAATGGGTCTGATCAGCGACGTATCCGAAGCTGCCGCCCGCGCGCACACGCCGAAAGTCGCCTTCGTCGCGCCCGCCGCCGATTACACCGCCTCCAGTGGCAAAACCGTGAATGCCGCCGACATCGATTTGCTGGTACGCGCCCTGAGCATGGGCAAATTGCACCACGCGATGATGGGTACCGCCTCTGTTGCCATTGCGACCGCCGCCGCCGTGCCCGGTACGCTGGTCAACCTTGCCGCA------GGCGGCGGAACG---CGTAAAGAAGTGCGCTTCGGGCATCCTTCCGGC------ACATTGCGCGTCGGTGCAGCCGCCGAATGTCAGGACGGACAATGGACGGCCACCAAAGCGGTTATGAGCCGCAGCGCACGCGTGATGATGGAAGGTTGGGTCAGGGTGCCG
Q9I5E5_PSEAE/6-391 CAGATCCGCATCCCCGCCACCTACCTGCGCGGCGGCACCAGCAAGGGCGTGTTCTTCCGCCTGGAAGACCTGCCGGAATCCTGCCGGGTCCCCGGCGAGGCGCGCGACCGGCTGTTCATGCGGGTGATCGGCAGTCCCGACCCCTATGCCGCGCACATCGACGGGATGGGCGGCGCCACCTCCAGCACCAGCAAGTGCGTGATCCTCTCGAAGAGCAGCCAGCCGGGCCATGACGTCGACTACCTCTACGGCCAGGTCTCCATCGACAAGCCCTTCGTCGACTGGAGCGGCAACTGCGGCAACCTCTCCACCGGGGCCGGCGCCTTCGCCCTGCACGCCGGGCTGGTGGATCCGGCGCGGATACCGGAAGACGGCATCTGCGAGGTGCGCATCTGGCAGGCCAATATCGGCAAGACCATCATCGCCCACGTGCCGGTGAGCGGCGGCCAAGTCCAGGAAACCGGCGACTTCGAGCTGGACGGAGTGACCTTCCCGGCGGCCGAGATCGTGCTGGAGTTCCTCGACCCGTCCGACGACGGCGAGGACggcGGCGCCATATTCCCCACCGGCAACCTGGTGGACGACCTGGAGGTGCCGGGGGTCGGCACCTTCAAGGCGACCATGATCAACGCCGGGATTCCCACGGTGTTCGTCAATGCCGAGGAGATCGGCTACCGCGGCACCGAGCTGCGCGAAGAGATCAACGGCGACCCGCAGCAACTGGCGCGCTTCGAACGGATCCGCGTCGCCGGTGCCCTGCGCATGGGCCTGATCAAGACCCCCGAGGAAGCCGCGACCCGCCAGCACACGCCGAAGATCGCCTTCGTCGCCCCGCCCCGCGACTACCGCACCGCCAGCGGCAAGCTGGTGGCGGCCGGCGATATCGACCTGCTGGTCCGCGCGCTGTCCATGGGCAAGCTGCACCACGCGATGATGGGTACCGCGGCGGTGGCCATCGGCACCGCCGCAGCCATTCCCGGCACCCTGGTGAACCTCGCCGCC------GGCGGCGGCGAA---CGCAGCGCGGTACGCTTCGGCCATCCCTCCGGC------ACCCTGCGAGTGGGCGCCGAGGCCAGCCAGGCGAACGGCGAATGGACGGTGACCAAGGCGATCATGAGCCGCAGCGCGCGAATCCTCATGGAAGGCTGGGTGCGCGTACCC
Q9KSB9_VIBCH/7-389 CAAATTCGTATTCCAGCCACCTACATGCGCGGCGGAACCAGCAAAGGGGTGTTTTTCCGTCTGAACGATTTGCCGCTTGAAGCGCAGCTTCCCGGTGCGGCCCGTGATGCTCTGTTGTTACGAGTGATTGGTAGCCCAGATCCTTACGGTAAACAGATTGATGGCATGGGCGGCGCGACATCGAGCACCAGCAAAACGGTGATTGTCAGTGCCAGTTCGCGCACTGATCACGATGTGGATTATCTGTTCGGGCAAGTGGCGATAGATAAACCGTTTGTCGATTGGAGCGGAAACTGCGGCAACCTTTCCGCTGCGGTGGGGCCCTTTGCGATCCATGCTGGGCTGATTCCTGCTGAGTGCATTCCGCACAATGGTGTGGTGGCGGTGAAAGTGTGGCAAGTCAACATCAGCAAAACCATTGTGGTGCATGTGCCGATAGTCAATGGCGCAGTGCAGGAGTGCGGTGAATTTGAACTCGATGGCGTGACCTTTGCGGCTGCCGAAGTGCAGGTCGATTTTGTGGATCCTGCGGATGACAGC------...GGCGCTATGTTCCCAACTGGTAACGTGATGGATGATTTACAAGTGCCGGGTATCGGCACGTTAAATGCGACTTTCATCAACTCGGGCATTCCAACCATTTTTGTCGATGCCGAAGCGCTTGGCTATCAAGGCACTGAGTTGCAAGAGGCCATCAACAGTGATCCACAAGCCTTGGCCAAGTTTGAAACGCTACGCGCTTATGGCGCACTGAAAATGGGTCTGATTGAGCGCATTGAAGAAGCGCAAAACCGTCAGCACACGCCAAAAATTGCTTTTGTCAGTGGCGCGAAAAGTTACTTAGCTTCAAGCGGTAAGCGAGTAGAAGCGGATTCCGTGGATCTGTTGGTGCGCGCGCTCTCGATGGGCAAACTGCATCACGCCATGATGGGCACGGCCGCCGTGGCGATTGCTTCTGCTGCCGCCGTTCCGGGCACGTTGGTCAATTTGGCTGCC------GGGGGCGGCGAG---CGTACGTCAGTCACCTTTGGTCATCCCTCCGGC------ACGTTAAAAGTCGGAGCGAAAGCCAAGCAAGGTAAACAAGGCTGGCAAATTGAGCGCGCGATCATGAGCCGCAGCGCCAGAATTCTAATGGAAGGATGGGTACGCGTTCCC
Q9PDY6_XYLFA/22-406 CAATGCCGTATCCCTGCGACGTATCTACGTGGCGGTACCAGCAAAGGTGTGTTCTTTCGCTTGGAGGAGTTGCCTCCAGCCTGCCGTGTGCCAGGCCCTGCGCGTGATGCCTTGTTACTGCGCGTCATCGGCAGCCCAGATCCCTATGGGAAGCAGATCGACGGAATGGGAGGCGGCAGCTCAAGTACCAGTAAAGTGGTGATCATCGCGCCGAGTGCCTATCCCAATCACGATGTGGATTATTTGTTTGGTCAAGTTGCGATTGAGCGTGCCTGTGTCGATTGGACAGGAAATTGCGGCAATTTGTCCGCCGCAGTGGGGCCATTTGCCATTGCTGCCGGTATTGTCGATCCGGCACGGGTGCCACATCGCGGGATATGCAGTGTGCGGATTTGGCAAGCCAATATCGGTAAAACCATCGTTGCACATGTGCCGATCATTGATGGACAGGTGCAGGAGAGTGGCGATTTCATGATGGAGGGGGCTGCTTTCCCGGGGGCTGAAGTGCGCTTGGAGTTTTTCAATCCTGCGGATGTGGGCGGAGAT...CGCGCGATGTTTCCGACGGGGCACCTGATCGATACGTTGGAGGTGCCAGGATTGGGGCCGATTGAGGCCACCTTGATCAATGCGGGGATACCGATGCTTTGTGTGGATGCCCATGCCCTGGGCTACACCGGTACCGAGCTACAAGAGGCGATCAATGGTGATCCGCATGCGTTGGTTTGTCTGGAGACGTTACGCGCCTATGGGGCGTTGCGTATGGGAGTGATCGGACATTTAGAAGACATGGTCCAGCATCAGCACACCCCTAAACTTGCTTTTGTTGCACCGCCTGCCGACTACGTCGCCTCCGGTGGTCGGCACGTACATGCCACAGAAATTGATGTCCTGGTGCGGGCAATGTCCATGGGCCGGTTGCACCACGCGATGATGGGTACCGCCGCCGTGGCGCTGGGGACGGCGGCGGCAATCCCCGGCACGCTGGTCAATCGTGCGGCT------GGTGGCGGGCTG---CGTCGTGTGGTCCGCTTTGGCCATCCCTCCGGC------ACCTTGCAAGTTGGGGCCGAAGTACATCAAGTGGATGGGCAATGGTCTGTCTCCAACGTGCGGATGAGCCGCAGTGCCCGTGTGCTGATGGAAGGTTGGGTGCGTGTGCCG