EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04301 alignment
(3 sequences with 645 bp)


Q9PIJ4_CAMJE/1-203 ATGAAATATGAATTTTTATGTAAAAATCCTGATTCAAAAAAACTTATAGTGGTATTTGGGGGATTTGCTTCACATTCTAGTCATTTTTCGCATTTAAAAAGCGATAAAAAT------GTGATTTTATTTTATGATTATGAAAATTTTGATTTAAATTTTGATTTCAAAGCTTTTGATGAACTTTTTTTAATCGCTTTTTCTATGGGGGTTTGTGTGGCAAATAGACTTTTAAAAGAGCTTAATTTTAAACAAAAAATAGCCATAAATGGCACAAATTTAGGCATAGATAAATCAAAAGGAATTCATCCTGCAATTTTTAGAAAAACCTTGCAAAATTTCAAATTAGAAAAT---------TTCAAAGAAGCTTTATTTAAAGAACGCAAAAATTTAACTAAAGATTTTATTTTTAAAGATGAAAAA---GCTTTAAAAATAGAGCTTGAAAAACTTTTTGACTTTGCTTTAGTAAAACAAGAA---------GAAAATTTGCTTTGGGATAAGGTTTATTCAAGTAAAAAAGATGAAATTTTTCCACCAAAT---------GCTTTAAAAAATGCTTTTTCAAAACTTATTTTTTTAAATGAACCGCATTTTGCTTTTTTTCATTTTAAAACTTGGGATGAGCTT
Q9CJT9_PASMU/1-213 ATGAAAACACAACATATTTCACAGCAAGGCGACAAT------CTGATCGTCTATTTTGCAGGGTGGGGCACACCGCCGAGCGTGGTCGAGCACCTGATTCTGCCGGAAAATTATGATTTATGCCTTTGCTATGATTATCGAGATCTGCATTGCGATGTTGATTTTTCCGCTTATCAACATATTCGCGTGGTGGCATGGTCAATGGGCGTGTGGGTAGCGGAGCGTGTGATGCAAGGTTATCCACTGCTATCTGCTACGGCGATCAATGGCACGGGCTTGCCTTGTGATGACCAATATGGTATTCCCGAAGCTATTTTTGCTGGCACGTTATCTGGTTTAAATGAAGATAATCGGACTAAATTTGAACGTCGTATTTGTGGTTCAAAAACGTTGTTAAGGGATTATCAGCACTATTCCATGCGTCCCACATTACAGGAAATTCATGCTGAACTGACCGCACTTTATACCTTTTTACAACAAGATCGCCGCACAGATTTAATCTCGTGGAGCAAGGCGATTGTCGGCTCAAAAGATAAAATTTTCCCTGCACAAAACCAGCGGGCTTATTGGCAGGATCGTTGTGCAATAACGGAAATCGCAGGGGAGCATTTGTTGTTTCCTCACTTCACCCATTGGGAAACTTGT
Q9K0T9_NEIMB/1-212 ATGGAAACAAAATTTTACAATCATCAAGGCGGACAT------TTAATCCTGTATTTTGCAGGTTGGGGAACGCCGCCCGATGCTGTAAATCATTTGATTTTGCCGGAAAATCACGATTTATTGATTTGCTATGATTATCAAGATTTAAATTTGGATTTTGATTTTTCCGCCTATCGGCACATCCGTTTGGTGGCGTGGTCAATGGGCGTTTGGGCGGCAGAGAGGGCATTGCAAGGAATAAGATTAAAATCCGCAACGGCAGTGAATGGCACAGGTTTGCCTTGCGATGATAATTTCGGTATCCCTTGCACCGTTTTTAAAGGCACATTGGAGAACCTCACGGAAAACACCCGTTTAAAATTTGAACGCAGAATGTGTGGCGATAAAGCATCTTTTGAAGATTACCAACAATTTCCCGCACGCCCG---TTTGGCGAAATTCATCAAGAACTTATCGCACTTTTTGCGATGATCGGGCAAGATAGACGTACAGATCTTATCCGCTGGACAAATGCCTTGGTCGGATCGGGCGATAAAATTTTTATGCCTGCCAATCAGCACCGATATTGGACACCGCGTTGCACCGTTCGGGAAATTGACGTCGGACATTACCTGTTTTCAAGATTCACCCATTGGTCGGCACTA