EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04195 alignment
(2 sequences with 552 bp)


Q9LG68_ORYSA/1-181 ATGGCACGGGGCTCCGCACCGCTCGATGGTAGCGTGCTGCCGCCTTCCCGCATCGTGAGCGAGAGGCAGGCCGGGCTGCCGCGCCGATTCATGCCGGAATCTGCCACCGGCCGGGAGGTGGTCGCGCTGGGCGAGGGACGCCCGACGCCACACTACCCGGGGCGGTCCGTCTTCTTCCTCTCTTTCGCAATGGCAGGGCTGGTCCCGCCATTCTCTTCTTTTTTCATGGATATTCTGGAGTTTTATGATCTCCAAATGGCGCACCTCACCCCCAACGCGGTAATGATGTTGGCCATCTTTGCGCACCTGTGCGAGATGTTCATCGGGGTGCGCCCATCTCTCTGGCTGTTCCAGTGGTTCTTCACCGTACAGCTG---------GTGTCGCCGCCGTTAGTAGTCGGTGGCTGCTACTTCCAGCCGCGGGGGCAGGTGCTGAACCGCTACATTCCCTGCGTCCTCCACAAGAAGTGGGACGACTGGAAGAGCGACTGGTTCTACACCCCCCTCGCCGACGAAGCGCGCCTCCGACTTCCGAGCCAGCCCCCG
Q9AYG4_ORYSA/1-180 ATGGCGGAGGAGAGAGAAAGCTTTGAGAGCCAATGGGCTCCCTCCGATGTTACTGAGGAGAACTTGAAGGAAATGGTGGCGCACGACGTTCTTCCGGCAAAGGAGATCATCGGCTGGCGTCCAGCGTGTGGCGAAGCATTCCCAACTCCTGACATGCAT---GAGGTCGTGGTATTCTCCCATTTCTTCTACGATGGTTTTTCTCTTCCAACTTTGAAATTCTTCAGGGGGATTCTTGAGTTTTATGGGATCAGCTTGCATCATCTTAACCCCAATTCCATAGTCCACATTGCCAACTTTATCCACACCTGTGAAGCCTTTCTAGGGATTAGGCCACATTTTGTCCTGTTCCGCCGCATCTTCTTCCTGAAGCCCCAGCCAAATAAGAGCAAGCCATGCGTTGTTGGGGGTGCCGGTTTTCAGCTAAGGGGCACCCTGAGCCAGAAATATTTCTCTATGCCTTTCAAAACATCAAACAAAGGCTGGCACGCAAACTGGTTTTATGTGCAAAATCCTGAACCGGCG---------CTTCCTGAGTACTCTTAC