EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04162 alignment
(22 sequences with 1347 bp)


Q96673_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACTCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGGGAACAATTGGCCTAATGGCTGCGTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGGACAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
Q9YKK6_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGGAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGATCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAACTGGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACTAGCCGCGGAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCTAAAAGGCGGACAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTCGGAACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
Q9YIV9_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGGAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGATCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCGCAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAACTGGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACTAGCCGCGGAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGAGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCTAAAAGGCGGACAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
Q9YKK8_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAAATATAGATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAACTCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACTAGCCGCGGAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCCAACAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACATTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
O41449_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAACTCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACTAGCCGCGGAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCCAACAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCCTGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAGCGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
Q9YKK7_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAAATATAGATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAACTCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGCGGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCCAGCAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGACCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTACCGCTCGGTACTGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
Q9YJ45_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGCGGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
VP1_CAVC1/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACTCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGGGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCCTCAATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGCGGACAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCAAAAAGGCGGACAACCGATGACGGGGGGCATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGTCAGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAACAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
VP1_CAV26/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGGAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGATTCCAAGGAGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTAAACCTGAAAGAGTTCCTGCTAGCGTCAATGAACCTGACATACGTGAGCAAAATCGGAGGACCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGCGGAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACATGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTTACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGGACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCACTACTACAGCCCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAAGGCCAGAGATGGCACACGCTGGTGCCCCTGGGCACGGAGACCATCACCGACAGCTACATGAGTGCACCCGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAAAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAGCTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCCAACAGCACCATGTACTGGGAGACGCAGCCC
VP1_CAV82/1-449 ATGGAAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGAACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTAAGGCTGCCGAACCCCCAATCTACGATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCGGTGAACCTGAAAGAGTTCCTACTAGCGTCAATGAACCTGACATACGTGAGCAAACTAGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCAGAAGCCGCGGAGAATTGGCCTAATTGCTGCGTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAACAAATGACCCTGCAAGACATGGGGCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGGGCAACCGATGACGGGGGGGATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCAGTACTACAGCGCAAGGCACGCAAGTCCGGTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCGCTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCGTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGCCAGAGATGGCACACGCTGGTGCCACTCGGCACGGAGACCATCACCGACAGCTACATGGGAGCACCGGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATTCATGGGCAGTGGTACGCGTCCAGTCGGTGTGGCAACTGGGTAACAGACAGAGGCCATACCCATGGGACGTCAACTGGGCGAACAGCACCATGTACTGGGGGACGCAGCCC
Q9IZU5_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCAAACCCCCAGTCCACGATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACCGAAGGACTCATTCTACCTAAAAACAGCACAGCTGGGGGCTATGCGGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCAGTGAACCTGAAAGAGTTCCTCCTAGCATCAATGAACCTGACATACGTGAGCAAGATAGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCGCAAGCCGCGGAGAACTGGCCAAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCTGCATGGTGGAGATGGGCTTTAATGATGATGCAGCCAACGGACTCCTGCCGGTTTTTTAATCACCCTAAGCAAATGACCCTGCAAGACATGGGTCGGATGTTTGGGGGCTGGCATCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGCCGCGACGATGTTAAGTACAGCAGCGACCACCAGAACCGGTGGCGAAAAGGCGAGCAACCGATGACGGGGGGGATTGCTTACGCGACCGGTAAAATGAGACTCGACGAGCAACAATACCCTGCTATGCCCCCGGACCCCCCGATCATCACCACTACCACTGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCGTGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCTCAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCATCACAAGGCCCGAGGAGCCGGGGACCCCAAGGGCCAGAGGTGGCACACGCTGGTGCCGCTCGGCACAGAGACCATAACCGACAGCTACATGAGAGCACCGGCATCAGAGCTGGACACGAATTTCTTCACGCTTTACGTAGCGCAAGGCACTAATAAATCGCAGCAATACAAGTTCGGCACAGCAACATACGCGCTAAAGGAACCCGTAATGAAGAGCGATTCATGGGCAGTGGTGCGCGTCCAGTCCGTCTGGCAACTGGGTAACAGGCAAAGGCCATACCCGTGGGACGTTAACTGGGCCAACAGCACCATGTACTGGGGGTCGCAGCCC
Q9JGP0_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACCATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCGTCAATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCAGAAGCCGCGGAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACATGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAGCAGATGACCCTGCAAGATATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCAGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCAGTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGATACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAAGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGGGAGCACCCGCATCAGAGCTGGACACTAATTTTTTTACGCTTTACGTAGCGCAAGGCACAAATAAATCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTGCGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAGAGGCCATACCCATGGGACGTAAACTGGGCCAACAGCACCATGTACTGGGGGACGCAGCCC
Q9DXA7_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACCATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACAGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCGTCAATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCACAAGCCGCGGAGAACTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTATTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAATACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCAGTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAAGGCCAGAGATGGCACACCCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGGGAGCACCCGCATCAGAGCTGGACACAAATTTCTTTACGCTTTACGTAGCGCAAGGTACAAATAAGTCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATTCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAGAGACCATACCCATGGGACGTCAACTGGGCCAACAGCACCATGTACTGGGGCGGGCAGCCC
VP1_CAVAU/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCAAACCCCCAGTCCACGATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACCGAAGGACTCATTCTACCTAAAAACAGCACAGCTGGGGGCTATGCGGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCAGTGAACCTGAAAGAGTTCCTCCTAGCATCAATGAACCTGACATACGTGAGCAAGATAGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAATCGCAAGCCGCGGAGAACTGGCCAAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCTGCATGGTGGAGATGGGCTTTAATGATGATGCAGCCAACGGACTCCTGCCGGTTTTTTAATCACCCTAAGCAAATGACCCTGCAAGACATGGGTCGGATGTTTGGGGGCTGGCATCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGCCGCGACGATGTTAAGTACAGCAGCGACCACCAGAACCGGTGGCGAAAAGGCGAGCAACCGATGACGGGGGGGATTGCTTACGCGACCGGTAAAATGAGACCCGACGAGCAACAATACCCTGCTATGCCCCCGGACCCCCCGATCATCACCAGTACCACAGCGCAAGGCACGCAAGTCCGCTGCATGTATAGCACGCAAGCTTGGTGGTCGTGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCTCAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGATCGTTCAACCATCACAAGGCCCGAGGAGCCGGGGACCCCAAGGGCCAGAGGTGGCACACGCTGGTGCCGCTCGGCACAGAGACCATAACCGACAGCTACATGGGAGCACCGGCATCAGAGCTGGACACGAATTTCTTCACGCTTTACGTAGCGCAAGGCACTAATAAATCGCAGCAATACAAGTTCGGCACAGCAACATACGCGCTAAAGGAACCCGTAATGAAGAGCGATTCATGGGCAGTGGTGCGCGTCCAGTCCGTCTGGCAACTGGGTAACAGGCAAAGGCCATACCCGTGGGACGTTAACTGGGCCAACAGCACCATGTACTGGGGGACGCAGCCC
Q9DTF1_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACAGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTAAACCTGAAGGAGTTCCTGCTAGCGTCAATGAACCTAACATACGTGAGCAAACTCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAAGCACAAGCCGCGGAGAACTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAGCAAATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATAATCACCAGTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCATAAGGCGAGAGGAGCCGGGGACCCCAAAGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGGGAGCACCCGCATCAGAGATAGACACGAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAGCACTACAAGTTCGGCACAGCTACATACGCGCTGAAGGAGCCGGTAATGAAGAGCGATTCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAAAGGCCTTACCCATGGGACGTCAACTGGGCCAACAGCACCATGGACTGGGGGTCGCAGCCC
Q9DTF4_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACAGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTAAACCTGAAGGAGTTCCTGCTAGCGTCAATGAACCTAACATACGTGAGCAAACTCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAAGCACAAGCCGCGGAGAACTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAGCAAATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATAATCACCAGTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCATAAGGCGAGAGGAGCCGGGGACCCCAAAGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGGGAGCACCCGCATCAGAGATAGACACGAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAGCACTACAAGTTCGGCACAGCTACATACGCGCTGAAGGAGCCGGTAATGAAGAGCGATTCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAAAGGCCTTACCCATGGGACGTCAACTGGGCCAACAGCACCATGTACTGGGGGTCGCAGCCC
Q9DTF2_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACAGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTAAACCTGAAGGAGTTCCTGCTAGCGTCAATGAACCTAACATACGTGAGCAAACTCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAAGCACAAGCCGCGGAGAACTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAGCAAATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATAATCACCAGTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCATAAGGCGAGAGGAGCCGGGGACCCCAAAGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGGGAGCACCCGCATCAGAGATAGACACGAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTGAAGGAGCCGGTAATGAAGAGCGATTCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAAAGGCCTTACCCATGGGACGTCAACTGGGCCAACAGCACCATGGACTGGGGGTCGCAGCCC
Q9DTF3_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGAGTCATCTTTCTCACAGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACATGTACGGGGCGAGAGTCGCCAAGATCTCTGTAAACCTGAAGGAGTTCCTGCTAGCGTCAATGAACCTAACATACGTGAGCAAACTCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTAAAGCAGAAGCCGCGGAGAACTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAGCAAATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATAATCACCAGTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCATAAGGCGAGAGGAGCCGGGGACCCCAAAGGCCAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGGGAGCACCCGCATCAGAGATAGACACGAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTGAAGGAGCCGGTAATGAAGAGCGATTCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAAAGGCCTTACCCATGGGACGTCAACTGGGCCAACAGCACCATGTACTGGGGGTCGCAGCCC
Q9WB34_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCAGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTACCGAACCCCCAGTCAACGATGACTATCCGCTTTCAAGGAATCATTTTTCTTACCGAAGGACTCATTCTACCTAAAAACAGTACAGCGGGGGGATATGCAGACCACCTCTACGGGGCGAGAGTCGCCAAGATCTCAGTGAACCTGAAAGAGTTCCTCCTAGCGTCAATGAACCTGACATACGTGAGCAAAATAGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTCAATCACAAGCCGCGCAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCTTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCAAAGCAAATGACCCTGCAAGACATGGGTCGGATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATATTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAGCAACCGATGACGGGGGGTATTGCTTATGCGACGGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCCGACCCCCCGATCATCACCACTACCACACCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCGTGGGACACATATATGAGCTTTGCGACACTCACAGCGCTCGGTGCACAATGGTCTTTCCCTCCAGGGCAACGTTCAGTTTCTAGACGCTCGTTCAACCACCACAAAGCGAGAGGGGCCGGGGACCCCAAGGGACAGAGATGGCACACGCTTGTTCCGCTCGGCACAGAGACCATCACCGACAGCTACATGAGTGCACCGGCATCAGAGCTGGACACTAACTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAATCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAACCGGTAATGAAGAGCGATGCATGGGCGGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAAAGGCCATACCCATGGGACGTCAACTGGGCCAACAGCACCATGTACTGGGGGTCGCAGCCC
Q96672_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCAGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTACCGAACCCCCAGTCAACGATGACTATCCGCTTCCAAGGAATCATTTTTCTTACCGAAGGACTCATTCTACCTAAAAACAGTACAGCGGGGGGATATGCAGACCACCTGTACGGGGCGAGAGTCGCCAAGATCTCAGTGAACCTGAAAGAGTTCCTCCTAGCGTCAATGAACCTGACATACGTGAGCAAAATAGGAGGACCCATCGCCGGTGAGTTGATTGCGGACGGGTCTCAATCACAAGCCGCGCAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCTTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAACAAATGACCCTGCAAGACATGGGTCGGATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAGCAACCGATGACGGGGGGTATTGCTTATGCGACGGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCCGACCCCCCGATCATCACCACTACCACACCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCGTGGGACACATATATGAGCTTTGCAACACTCACAGCGCTCGGTGCACAATGGTCTTTCCCTCCAGGGCAACGTTCAGTTTCTAGACGCTCGTTCAACCACCACAAAGCGAGAGGGGCCGGGGACCCCAAGGGACAGAGATGGCACACGCTTGTTCCGCTCGGCACAGAGACCATCACCGACAGCTACATGAGTGCGCCGGCATCAGAGCTGGACACTAACTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAATCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAACCGGTAATGAAGAGCGATGCATGGGCGGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAAAGGCCATACCCATGGGACGTCAACTGGGCCAACAGCACCATGGACTGGGGGTCGCAGCCC
Q96674_9CIRC/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCAGATTTTACGCCTTCAGAAGAGGACGGTGGCACCACCTCAAGCGACTTCAACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTACCGAACCCCCAGTCAACGATGACTATCCGCTTTCAAGGAACCATTTTTCTTACCGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACCTGTACGGGGCGAGAGTCGCCAAGATCTCAGTGAACCTGAAAGAGTTCCTCCTAGCGTCAATGAACCTGACATACGTGAGCAAAATAGGAGGCCCCATCGCCGGTGAGTTAATTGCGGACGGGTCTCAATCACAAGCCGCGCAGAATTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCTACACCATCGGCATGGTGGAGATGGGCTTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTTTTTAATCACCCTAAACAAATGACTCTGCAAGACATGGGTCGGATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAACCACCACAAGGCGAGAGGAGCCGGGGACCCCAAGGGACAGAGATGGCACACGCTGGTGCCGCTCGGCACGGAGACCATCACCGACAGCTACATGAGTGCACCGGCATCAGAGCTGGACACTAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAATCTCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAACCGGTAATGAAGAGCGATGCATGGGCGGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAAAGGCCATACCCATGGGATGTCAACTGGGCCAACAGCACCATGTACTGGGGGACGCAGCCC
VP1_CAVCI/1-449 ATGGCAAGACGAGCTCGCAGACCGAGAGGCCGATTTTACGCCTTCAGAAGAGGACGGTGGCACAACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGGCTGCCGAACCCCCAATCTACTATGACTATCCGCTTCCAAGGAATCATATTTCTCACGGAAGGACTCATTCTGCCTAAAAACAGCACAGCGGGGGGCTATGCAGACCACTTGTACGGGGCGAGAGTCGCCAAGATCTCTGTGAACCTGAAAGAGTTCCTGCTAGCGTCAATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTGATTGCGGACGGGTCTCAATCACAAGCCGCGCAGAACTGGCCTAATTGCTGGCTGCCGCTAGATAATAACGTGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCCTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAACCACCCTAAGCAGATGACCCTGCAAGACATGGGTCGCATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAGACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCGAGTCTTCTCTCCCAGGGAGAGTACCTCACGCGTCGGGACGATGTTAAGTACAGCAGCGATCACCAGAACCGGTGGCGAAAAGGCGAACAACCGATGACGGGGGGTATTGCTTATGCGACCGGGAAAATGAGACCCGACGAGCAACAGTACCCTGCTATGCCCCCAGACCCCCCGATCATCACCGCTACTACAGCGCAAGGCACGCAAGTCCGCTGCATGAATAGCACGCAAGCTTGGTGGTCATGGGACACATATATGAGCTTTGCAACACTCACAGCACTCGGTGCACAATGGTCTTTTCCTCCAGGGCAACGTTCAGTTTCTAGACGGTCCTTCAATCACCACAAGGCGAGAGGAGCCGGAGACCCCAAAGGGCAGAGATGGCACACGCTGGTGCCGCTAGGCACGGAGACCATCACGGACAGCTACATGAGTGCACCTGCATCAGAGCTGGACACGAATTTCTTTACGCTTTACGTAGCGCAAGGCACAAATAAGTCGCAGCAGTACAAGTTCGGCACAGCTACATACGCGCTAAAGGAGCCGGTAATGAAGAGCGATGCATGGGCAGTGGTACGCGTCCAGTCGGTCTGGCAACTGGGTAACAGGCAGAGGCCATACCCATGGGACGTCAACTGGGCCAACAGCACCATGTACTGGGGGTCGCAGCCC