EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04016 alignment
(4 sequences with 777 bp)


Y500_METJA/4-258 ATGATAATAGAAGAGATAAAAGAGAGAGCTTTAAATCTGCTAAGTGAGAAAGAAGAAGATTTTAAAGTTATTGATTTCTCCTTTGCCTTGCCTTATAGCTATGTATTAATTGAAAGCAATGGCAAAAAAGCTTTGGGAGTGGCAATGACGTTATTGGAGGAATATAGAGGGCATGGAAATAGGAAAGATTTAAATATAAATAAAAATTTGGAAGAGTTTATAAACATGGCAGATAGTTTTGATATTGTTGAAAGAACTTTGGGAGTTGCAGCTATCAATGCAGTATCTCAATACTATTTTAACTTT---GAAGCTAATGGAAAAGATGCCGCTGAGTTAGTTTTAAATAGAGACGATATTAAAAAAATAGCTTTCGTTGGAAATATGATTCCAGTTGTTAATATGCTGAAAAAATCTGAAAAATTTGATATCTATGTGTTTGAGAGAAGTCCTTCACTATTGATG------GATGGAGTTTTAAGCGATGCCTTTGAATATAGGTTATTGCCAGAGATGGATGCCGTATTTATCAGCGGAACTACTCTGCTAAATGATACATTGGATTTTGTTTTAGATAGGGCTAAAAATGCCAAGTTAAAGATTTTAGTAGGACCTACAGCTCAATCTTTGCCAGAGCTATTTAAAGGATTTGGCATAACACATATAGCATCAACAAAGATTATAGATGTTGATAAAGCTCTCCTATATTTAAAATTTGCCTCT---TCTTCAATGCTATTCAAGGGAGCATCAAAGAAATACACTATGGAGGTA
Q9V0X5_PYRAB/1-244 ATGATACTCTCCAAGATTAAGAAGGAAGCCCTAAAGCTTATT------------GACGAGCTCGAACTACTCGACTTCAGCTTCGCCCTTCCATACACCTGGGTTCTAGTTAAAGGGGAAGAAGGTAAATCGCTCGGAGTTGCCATGACGTTGCCGGAGGAAGTTCAAAGGTACACAAGTTCAATAGAGGAA---------CCCTCGCTAGAGGAGTTCATAAGGAAGGCCGACAGCTTAAACGTCATAGAGAGAACCCTCGGGGTTGCGGCCATAAACGCAGTTTCCCAATACTACATTGATTTAAGCGACGCTTTTTGGGGAGATGTTCTCGATTTAGTTCAAGGAGAT------GTGAAGAGGATAGCTGTACTCGGTAACATGCCACCAATAGTCAAGGCCTTGAGG------AGTAAATACGAGGTCTACGTCTTCGAGAGGAACCCTAAGCTATGGGAC------AGGGAAACCTACAGCGACGCTTTAGAATACGATTTGCTTCCCAAGATGGACGTTATAATAGCGAGTGCCTCCTGCATCGTCAACGGGACGATAGATATGATCCTCGACAGGGCCAAGAAGGCTAAGCTTCTCATCCTCACTGGACCTACTGCTCAGCTACTTCCGGAGTTTCTAAAGGGAACTAAGGTTACACATCTAGCAGCGATGAAGGTCGTTGACATAGATAGGGCAATCCTTAAGCTAAAGCTTGGC------TCGTTCAGGGGCTTCGAGGAGGGAAGCAGGAAATATATAGTTAAAGTT
O59175_PYRHO/4-248 ATGTTATTATCGAGGATAAAGAAGAAAGCCATGGAACTTGCC------------GAAGACTTAAAGCTTGTAGATTTCAGCTTTGGATTGCCTTACACTTGGGTTCTCGTTGAAGGAATTGAAGGAAGAGCTCTAGGAGTTGCGATGACGCTACCGGAGGAAGTACAAAGGTATACAAATTCTATAGAGGAG---------CCTTCCCTACTAGAGTTCATAGATAAGGCGGATAGTTTAAATATTATAGAGAGAACCTTAGGAGTTGCCGCAATAAACGCGGTATCTCAGTACTACATAGACTTGAGGGAAGCCAAGTGGATCGACGTTACGGAACTAATCCAACAAGATGAG---ATTAAGAGGATAGCGATAATAGGGAACATGCCCCCAGTAGTTAGAACCCTCAAG------GAAAAGTATGAGGTTTATGTCTTCGAGAGGAATATGAAGCTATGGGAT------AGGGACACCTACAGCGATACCCTGGAGTACCATATCCTACCGGAGGTTGACGGTATAATAGCAAGCGCTTCCTGCATAGTTAATGGAACCCTTGACATGATATTGGATAGGGCAAAGAAAGCAAAGCTTATCGTTATTACGGGACCTACGGGGCAATTACTTCCTGAATTCCTCAAGGGAACAAAAGTAACCCATTTAGCAAGCATGAAAGTTACAAATATTGAAAAAGCCTTAGTCAAATTAAAGTTAGGT------TCCTTTAAGGGGTTTGAATCGGAGAGCATTAAGTACGTTATTGAAGTT
O27008_METTH/1-236 ATGATACTTGATGATATACTGGATGAGATTGAGAACATGCCT---------------GAAATCAGAGTAAGGGATGTGGCCATAGGCAGA------TCATGGACGGCTGTTTGGAGCAGC---------TCCTGCGGTATAGCCAGTAATAAT---------------GGATTCATCAGAGATTTTGAAATTCCA------GAGATGACTCATGAATTACTTGAACTTTCAAGGTCATGGGACCCATTTTATTCCAGCCTGGGAATTGCTACTGTTAACTCAGTGATCGAGGGAGGTGGTAAACGA---TGCAATGCATTTGATATACTGATGGAGGAATGCCGAAATCGA------AAA------ATCGCTATGGTGGGTGAATTCCCACGCCGCTACACTGACAGGATAAGGACGGTTTCGGACGAGTTCTATATTCTGGAGATCAATCCATTTAAGGTCAATCCTAAAAGGGGTGTTTTTCCTGAAACAGCGGCTGAACAGATTATCCCCCGGGTTGATGTACTTGCAGTGACTGGCAGCACACTGGTCAATCACAGCACAGAACGTTACCTTGCACTGGCAGAACTTGATGCTTTTGTGGCTATCATAGGACCCACAACGCCAATGACAGATGTTTTTTTTGAA---TACGGGGTTGATATGATTGCAGGGGTTGAAATAACTGATCCTGTTAATATTCTAAAGAAAATAAGGTTCAATGAGGGCATGTTACATGAAAAAGATGGAGGAATAATCTACAGGGTAATGGAGGCC