EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03923 alignment
(2 sequences with 621 bp)


YAJG_HAEIN/1-199 ATGGCATTAGTAAACAAAATTAAA------------ACATTATCATCAGTAGGTATTCTAGCGGCTACATTATTTCTTGCAGGCTGCCAAGCA---CAATCAAATATATTAGCATTTACGCCGCCTGCACCA---AGTGCTTCAATGAATGTTAATCGAACTGCCGTTGTATCTGTGACAACAAAAGATAGCCGTGCAATACAAGAGATTGCGAGTTATACGAAACACGGGGAACTGATTAAATTAAATGCATCCCCA------AGTGTTACACAATTATTTCAGCAAGTGATGCAGCAAAATTTAATTAGTAAAGGTTTTAGAGTTGGGCAATTAAATGGTTCAAATGCGTGGGTAACTGTGGATGTGCGTGAATTTGGTACGCAAGTAGAACAAGGTAATCTTCGTTATAAACTTAATACCAAAATTCAAGCGACAGTTTATGTACAAGGTGCGAAAGGTTCGTATAATAAATCATTTAATGTCACGCACTCACAAGAGGGCGTATTTAATGCGGGCAATGATGAAATTCATAAAGTGCTATCTCAAACTTTTAATGATATTGTGAACAATATTTATCAAGATCAAGAAGTTGCGGCTGCGATAAACCAATATTCTAAT
Q9KPR8_VIBCH/3-205 CTTGCGGCTGTGTGCACAATAAAACGAAAGGAATTAACCATGAAAAAACTGGTTCTTGCGGCTTCAATCGCTTTACTTACCGCTTGTTCTGCTCCTCAGCAGAGTCAAATCAACGTTAACCCTCAAGCGGCATTAAGCCAAAATGCGATTGTGAAT---AACAGCAGCTTTTCGCTGGTCAGCAAAGATGTGCGTTCAGCGCAATATGTGGCT---TTAGTCGATAGTGGTCGTAACAATATTGAGCCCATTCATCCACGCCAAAATGTGCGCATTACGCTAGAAAACGCCCTGGCTGAACAGTTTGGATCGCAAGGTTTCCGTCTCAGC---GTCAATAGTGAAAACACC---ATCACTCTCGAAATCCAAGAACTTTTGGTCTCCGTGAAGCACTCAATCATGGAAAACCAAATGGATGGCAGCGTGGTATTGGAAATCACGGCTGAAACACCAAGAGGCAAGTTGGTGAAAAGCTACACAGGCACCGCAAAACGTACTGGCGTTCTCAGTGCCTCTAACGATGAAATTGAAACCGTACTCAATGACGTGATCAACACTGTGCTCAAAGAGATCGCTAACGATGCCGAGCTGCAAAACTACATGCAGGAGCGCTTTAAT