EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03908 alignment
(6 sequences with 276 bp)


NIP1_HUMAN/176-267 CAGACATCCAGTACCATCACTGAGAGCCTCATGGGGATCAGCAGGATGATGGCCCAGCAGGTCCAGCAGAGCGAGGAGGCCATGCAGTCTCTAGTCACTTCTTCACGAACGATCCTGGATGCAAATGAAGAATTTAAGTCCATGTCGGGCACCATCCAGCTGGGCCGGAAGCTTATCACAAAATACAATCGCCGGGAGCTGACGGACAAGCTTCTCATCTTCCTTGCGCTACGCCTGTTTCTTGCTACGGTCCTCTATATTGTGAAAAAGCGGCTC
Q9VNI9_DROME/135-226 TCGCAGGAGAACGACGTGACCGAGAAGATGCTGGCTATATCGCGGCACCTCTCGGAGACCACCCAGAAGAGCGCCATCACCCTGGAAACGCTCGTGGCCTCGTCGCAAAATGTGGAGGCCACCAGCGACGAACTGCACCACACGGCCGGCAGCATTAGCATGTCCGGCAAGCTGCTCAAAAAGTACGGACGACGCGAGTGCACTGACAAAATGCTGCTCTTCTTCGCCTTCTCCTTGTTCCTCGCCTGTGTCTTTTACATCGTCCAAAAGCGACTC
Q9LK13_ARATH/183-274 TCCGATGCTGAAAGCATAACTGAAAGTCTCAGGCGTTCACGGCAGCTGATGGTTCAGGAGGTTGAACGAAGTACAAACACTCTCGTGGCTTTTGATGAATCTACTGGAGTACTTAAAAAAGCCGAGAGTGAATACAAAGGTCATAGATCTCTGTTGTCGAGGACCCGTAATCTACTTTCAACAATGCAGCGTCAAGATGTAATTGACAGGATAATCCTCATAGTTGGATTTTCTCTCTTTGTCTTTGCTGTTGTTTACGTTGTTTCAAAACGCATC
O42852_SCHPO/122-213 ACAAGCGCCAGTCAGGTCACGGCGGCTATGCGTGATATTCACGCACAAATGGTACAGGCAGTGGATATGAGTGCCGAAAATGCAATGGAGTTGTCTTCGAGTACCAACTTGTTAGAAACTCTACAAGAGAAATATTTTGGTGTAGAGGACGTTTTATATACAAGTAAACGGATAATCAAATCGCTCAAATTAAGTGATCGAAGTGATTACTTTTTAGTCGTCTCGGGATTTGGGTTCTTCATATTTGTGGTTGTCTATCTTCTCTTCAAGCGAATT
SEC20_YEAST/204-295 AGCAAAACAAAACAACTGACGAATAACTTGGTGAGAGGAAATCAAATTTTGCAGTCCGGAATTTTACAAAGTGACCTGAATTTGGATGAATTGAGAGCCCAAACCAATTCCTTAACACAAATCGATGACAAGTACACTCAATTCGAAACCGTCTTCAAGAAAACTGCCGATTTGGTCAAAGTACTGGAAAATGCCTCCCATCAAGAGAAACGAGATGTCTATTTATCACTTGGGTTCCTCCTATGCTGCGTCTCGTGGGTTCTATGGCGTCGTATT
Q9P887_CANAL/148-239 AGCCAAAATAAACAAATAACAAAATCCTTGCAAGCATCGAGACAATTGTTATCAGCAGGTATATTGCAGAGTGAATTGAACATTGACAACATTGATCAGCAAACCAAGGATTTATACAAGTTAAATGAAGGATTTATCCAATTCAACGATTTGTTAAATAGATCTAAGAAAATTGTCAAGTTTATTGAAAAGCAAGATAAAGCTGACCGTCAACGTATATATTTGAGTATGGGGTTCTTCATACTTTGTTGTTCTTGGGTGGTTTATAGAAGAATT