EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03886 alignment
(4 sequences with 546 bp)


Q9JYA5_NEIMB/5-172 CCGATTGCCGCCGCCCTGTCGCTTGCCGCCTGCGGTACTGTGCAAAGCACACAA------TATTTCGTGTTGCCCGACAGCCGC------TACATCCGTCCTGCAACGCAAGGCGGC---GAAACTGCCGTCGAAGTCCGTCTTGCCGAACCGCTCAAACGCGGC---GGACTGGTCTATCAAACCGACCCCTACCGCCTCAACACCGCACAAAACCACGTCTGGGCAGACACCTTGGACGATATGCTCGAAGCGGCGTTGAGCAATGCATTCAACCGTTTGGACAGCACACGCATCTTTGTTCCTGCCTCACGCAGCGGCAGTACCGAAAAA---------TGGACGGTCTATATCGACGCATTCCAAGGCAGCTACACGGGCAAAACCCTCATCAGCGGC---TACGCCGTCCTACCCGACGGT------------ACGAACAGACCCTTCCATATCGAAACCGAACAGCAGGGTGACGGCTACGCCGCGATGACCGCCGCACTCGAACAGGGACTGAAACAGGCGGCGCAACAGATGGTCGAG
YMBA_ECOLI/1-176 GTGACGATTGCAGCACTGTGGCTGGCCGGATGCAGCTCCGGCGAAATTAATAAAAAC---TATTACCAGTTACCTGTGGTGCAGAGCGGTACACAAAGTACCGCCAGCCAGGGCAATCGTCTGTTATGGGTAGAGCAGGTCACTGTTCCTGACTATCTGGCGGGGAATGGTGTGGTTTATCAAACCAGTGATGTGAAGTATGTGATTGCCAACAACAACTTGTGGGCCAGCCCGTTGGATCAACAGTTGCGCAACACCCTGGTTGCCAACCTGAGTACGCAACTGCCCGGCTGGGTGGTTGCCTCCCAGCCTCTGGGAAGCGCCCAGGACACG---------CTCAATGTTACCGTAACGGAGTTTAACGGTCGCTATGATGGCAAGGTCATTGTCAGTGGTGAGTGGCTGTTGAACCACCAGGGACAA------CTGATCAAACGTCCGTTCCGTCTGGAAGGAGTGCAAACTCAGGATGGTTACGATGAGATGGTTAAAGTGCTGGCCGGTGTCTGGAGTCAGGAAGCCGCTTCTATTGCACAA
Q9KR87_VIBCH/6-187 TTGATGATGTTAACCACACTGTTGGTCGGCTGCGGAGGAACGCCACAGCCCAAAGTCAGTTTTTATTTACTGCCAAACAACCCAGAACTTAGCGAGCATATCCAGCCCAAAACATTGCCTTTGCTGGTGGTTCAACCCGTGGAATTGGCGGCTTATCTAGATACGCAAGGGATTGTTTATCGTCAGTCGGAAACGCAAGTGATCCAAGCCAGACAAAACCAGTGGGCACAGCGGCTTAGCCCACAACTGACACAACGTATCACCAATGATCTGCGCCGTAAGCAATCTCGCTACTGGCCTGCACCTTTGAATGCTTCATCCATCCAGCAAGAGCACTGGAAACTACAGGTAAGATTGCAGCGATTTAATGGTGTCTACACGGGCAATGCCGAAGTGGCTGGCAATTGGGAACTGCTCAACCCAAAAGGAGAAAGCATGTTAAACCAAGAGTTTAGTTTTCAGGTGCCGCTCAAAGATACGGGTTACCCCGCTCTGGTTGAAGCACTCTCTGCGGGTGTAGATCAACTTTCAACTCAGATCGAAACC
Q9HUK2_PSEAE/11-187 TCCCTCGTCAGCCTGCTCGGGCTGACGGGTTGTGCGGTCCATCCGCCGGCCCAG------CTCTACCAGTTGGACGTCGGTGCC------GCCGCAGTACCGAAAAAGGATGGCGGTGCGGCCGTCCTGCTCGGCCCGGTACAACTGGCCGACTATCTCAAGCGCGATGTGATGGTGCAGCGGCAGGCCGACGGTATTCTCAGCCTGTCCACCGACGCGCGCTGGGCCGGCAACCTGGAGACCAATGTCAGCCAGCAACTGCTGCGGCAGATGTCCAGCGAGCTGGGCAGCAGCCGCCTGGCGCTGTTCCCGGAAAAACCCGGTTTCACCCCCCAGGTCCAGGTGATGCTGACCATCAGTCGCCTCGACTCCGGCCCCAAGCAGCCGGCAGTGATCGAGGCGCGCTGGCGCCTGTTGGACCAGAAGGGCGACCTGAAGGACAGCCGGGTGTTCCACGAGGAA---GAACAGCATCAGGGCAGCATCGGCGACCAGATCCGTGCCCAGAGCGACCTGCTCAAGCGCCTGGCGGCGCAGTTGGCCAAG